سپیده رستمی

Zinc is one of the most limiting trace mineral elements required for body growth, structure, hormonal and enzyme activity, nutrient metabolism, cell division, and immune system function. Zinc deficiency has been associated with reduced food intake, stunted growth, and decreased production of IGF-1 in the liver. Zinc plays a key role in the regulation of IGF family gene expression in various tissues and is also effective in desaturating linoleic acid, thereby preventing lipid peroxidation. There is a significant relationship between fat metabolism and zinc. On the other hand, flaxseed oil contains the essential fatty acid alpha-linolenic acid (omega-3), which appears to be related to IGF-1 function in the body. Therefore, this research investigated the effect of adding a zinc-methionine organic supplement to diets with and without the calcium salt of flaxseed oil on IGF-1 gene expression in the liver tissue of fattening lambs.

In this research, 44 Arab male lambs were used in a 2 x 2 factorial experiment within a completely randomized design, with four treatments and 11 replications. The four experimental diets were: 1) basic diet without Ca-salt of flaxseed oil supplement and without zinc-methionine supplement (CON), 2) basic diet without Ca-salt of flaxseed oil supplement containing 0.08% zinc-methionine supplement, 3) basic diet containing 3% Ca-salt of flaxseed oil supplement without zinc-methionine supplement, and 4) basic diet containing 3% Ca-salt of flaxseed oil supplement plus 0.08% zinc-methionine supplement. After the fattening period, three lambs from each treatment were slaughtered, and muscle tissue was transferred to the laboratory with liquid nitrogen. After RNA extraction and quality assessment, cDNA synthesis was performed. The expression of lipogenic genes was evaluated using the Real-time PCR method.

The presence of a single band in the range of 240 base pairs for the IGF-1 gene and 144 base pairs for the GAPDH gene on gel electrophoresis confirmed the accuracy of the test and the correct amplification of the desired fragments by polymerase chain reaction. The presence of a single peak in the melting curves of the IGF-1 and GAPDH genes in the real-time PCR reaction further confirmed the specificity of the produced products. The results showed that the addition of zinc supplements significantly increased the expression of the IGF-1 gene (P < 0.01), from 1 to 4.95. Additionally, the calcium salt of flaxseed oil supplement significantly increased IGF-1 gene expression (P < 0.01), raising it from 1 to 3.52. The interaction effects of the zinc-methionine supplement and calcium salt flax oil supplement were not significant. Simultaneous addition of the zinc-methionine supplement and the calcium salt flax oil supplement to the diet of fattening lambs increased IGF-1 gene expression in the liver.

The addition of a zinc-methionine organic supplement to diets containing a calcium salt flaxseed oil supplement increases IGF-1 gene expression. Increasing IGF-1 gene expression will likely enhance growth and overall production.

The sex of chickens considerably impacts production performance and economic benefits in poultry farming. Male birds cannot lay eggs and usually have a lower ratio of meat to feed than broilers. Male chicks are typically killed immediately after hatching since they are redundant in the industry and male chicks will neither be suitable for egg production nor meat production. Day-old male chicks in the laying hen industry are usually culled immediately after hatching. As a result, this issue has caused moral concerns in societies. Efforts are underway to develop technology for automatically determining the sex of chick embryos, aimed at establishing a stable and efficient poultry farming system. In large commercial hatcheries, the sexing of newly born chicks is generally accomplished by three different methods according to new hatching lines' vent, color, or feathers. However, these methods are still time- and labor-consuming. If sex can be identified at an early embryonic stage or even before incubation, male eggs could be used as feed components. Moreover, fewer eggs would need to be incubated, which would reduce feed space requirements, CO2 emissions, and energy consumption, which are all economically beneficial to farmers and the environment. In recent decades, researchers have used various in ovo sexing strategies in chicken eggs before hatching or incubation. Some invasive and noninvasive studies that have been conducted for in ovo sexing of chicken eggs can be divided into five major categories: (i) molecular-based techniques, (ii) spectral-based techniques (Raman spectroscopy, fluorescent, 3D X-ray), (iii) acoustic-based techniques, (iv) morphology-based techniques, and (v) volatile organic compound (VOC)-based techniques. Commercially applicable methods must be noninvasive, rapid enough for real-time applications, economically feasible, and ethically acceptable. An alternative method, to prevent the removal of day-old chicks, is a non-invasive method to determine the sex of the egg in the early stages of hatching before the development of the nervous system. Recently, Raman spectroscopy was reported to determine the sex of eggs at the incubation stage. Raman spectroscopy is based on the Raman effect, whereby when incident light (wavelength 750–850 nm) excites molecules in a tissue, the molecules reflect light at a different wavelength. The reflected light's wavelength is characteristic of various chemical components and allows the detection of the atheromatous plaque chemical synthesis. Raman spectroscopy is a powerful tool expected to revolutionize chick sex determination because it can provide information about biological molecules. Thus, Raman spectroscopy is suitable for analyzing living organisms, leading to its widespread adoption across various biological and medical applications. Therefore, resonance Raman spectroscopies have found application in blood analysis, with some studies exploring its utility in chick sexing. For this purpose, the present study was carried out to investigate the feasibility of determining the sex of Iranian native chicken embryos using the Raman spectroscopy. To carry out this research, 100 fertilized eggs of Iranian native chickens were used. The sex of the embryos was determined using Raman spectroscopy with a wavelength of 785 nm during the fourth day of incubation. Validation of this method was investigated using the polymerase chain reaction (PCR) technique. Sequence alignment of CHD-Z and CHD-W allele sequences amplified by PCR technique. The amplified DNA fragments were single and double DNA bands in the size of 461 bp for the CHD-Z and 322 bp for the CHD-W genes. The PCR was carried out using a PCR master kit with specific primers (the forward primer: 5′- TATCGTCAGTTTCCTTTTCAGGT -3′, the reverse primer: 5′- CCTTTTATTGATCCATCAAGCCT -3′). Thermal cycling conditions for DNA amplification were: 1 cycle of initial denaturation at 94°C for 5 minutes; 35 cycles comprising 30s at 94°C for the denaturation, 30s at 59°C for annealing, 30s at 72°C for the elongation; and a final extension cycle at 72°C for 5 minutes. The PCR products were analyzed by electrophoresis on 2.5% agarose gel against a DNA Ladder 100bp, and visualized using the safe staining on UV transilluminator. The data obtained from the Raman spectrometer was analyzed using the Origin software. The main indices used to study the data were the intensity of the Raman peaks and the ratio of the dominant peak intensity. Additionally, principal component analysis (PCA) was employed to identify any patterns in the data. To calculate PCA1 and PC2, the ratios of I769/I838 and I1141/I1251 peaks were considered, respectively. PCA analysis can choose features that have a greater impact on the final result, depending on the data and the scope of their changes. The result of PCR showed that one fragment with a length of 461 bp was amplified for male embryos (ZZ) and two fragments with lengths of 461 and 322 bp were amplified for female embryos (ZW(. The study found that there are differences in the intensity of Raman bands between genders. Males have higher intensity while females have lower intensity. Therefore, changes in Raman spectra intensity can be used to identify gender. Additionally, the candlestick chart of the data showed that median and average values for males were larger than for females. Furthermore, the results obtained from PCA analysis showed that the variance percentages for PC1 and PC2 were 53.69% and 46.31%, respectively. PC2 is more reliable as it has less deviation. Based on the results obtained from the study, it can be concluded that Raman spectroscopy is a reliable method for determining the gender of chicken embryos during incubation. This test is quick, accurate, and can be easily incorporated into the industry to determine the gender of embryos without resorting to the practice of killing day-old chicks. Not only is this method more ethical, but it also offers a high level of accuracy, making it an attractive alternative for the industry. In general, these results demonstrate the potential application of hematological traits in developing an automatic in ovo embryo sexing method through spectroscopic analysis.

Myrtle essential oil (MEO) has antimicrobial, antioxidant, and anti-inflammatory effects. Especially, tannins and flavonoids in MEO have antioxidant properties. So, it can be expected that MEO can affect the immune system of broilers. Therefore, in this research, the effect of MEO on the gene expression of cytokines (IL-1, IL-2, IL-4, and IL-10) in the tissues of the small intestine of broiler chickens was investigated. For this purpose, 120 Ross 308 broiler chicks in a completely randomized design with 2 treatments, 5 replicates and 12 chicks were used in each replicate. The treatments included: 1- control diet, 2- basal diet plus 250 mg / kg MEO. After 42 days, at the end of testing one chickens each replicate were slaughtered and their tissues were excised quickly and transported with liquid nitrogen to the laboratory. Quantitative real-time PCR was used to measure the expression of the cytokines. Analysis of variance showed that the addition of 250 mg/kg of the myrtle essential oil (MEO) in the diet of broiler chickens had no significant effect on IL-2 and IL-10 gene expression. While the expression of IL-1 and IL-4 genes had a significant effect. These results indicate that the myrtle essential oil can play a role in the cellular immune response in the small intestine of broiler chicken by reducing pro-inflammatory cytokines. So, the anti-inflammatory aspect of MEO could be used by adding it to the diet of broilers.

The effects of two different extenders were investigated (Tris- egg yolk and Andromed extenders) on semen quality and sex ratio during the dilution and freezing process in Holstien bull by using the real-time qPCR technique. The experiment was conducted using four 4-years old Holstien bulls for a period of four weeks in a completely randomized design. The PLP and SRY genes were amplified to isolate the specific fragments of X- and Y- chromosome sequences, respectively. Using Andromed diluent in comparison with Tris- eggs yolk improved semen quality during freezing and thawing. Using Andromed extender significantly increased the PLP gene expression (1.43±0.16), (P= 0/01) and reduced SRY gene expression (0.64±0.11), (P= 0/009). Using Tris- egg yolk extender led to a significant reduced in expression of PLP gene (0.3±0.06), (P< 0/0001) and s increased SRY gene expression during freezing (1.19±0.05), (P= 0/001). Based on the results, sperm dilution with Andromed extender and frozen semen with Tris-egg yolk increase birth of female and male in dairy cow herd, respectively.

This study was designed to investigate the use of different levels of soybean lecithin in the Tris extender on semen quality and sex ratio using real-time qPCR technique.

Sampling of 4 Holstien bulls was performed once a week, then the appropriate samples were mixed. Samples of sperm (in 4 replications) were divided into three groups: zero, one and two percentage soybean lecithin. The qualitative parameters and the sex ratio of the semen were determined. Swim up technique was used to wash the semen and remove the dead cells. Moreover, the PLP and SRY genes were propagated to separate the specific fragments of X- and Y- chromosomes sequences. In this procedure, PAR was used as a housekeeping gene to normalize the gene expression data in real-time qPCR.

The results showed that swim up technique and different levels of soybean lecithin improve the semen quality. In addition, swim up technique significantly reduced PLP gene expression (0.75±0.11), against increased SRY gene expression (1.37±0.13). However, using of different levels of soybean lecithin did not change the sex ratio of the sperms.

In general, soybean lecithin is an appropriate substitute to animal sources and improves the quality of semen. Due to the limitations of using animal resources in bull extenders, the use of soybean lecithin as a plant source is suggested.