به جمع مشترکان مگیران بپیوندید!

تنها با پرداخت 70 هزارتومان حق اشتراک سالانه به متن مقالات دسترسی داشته باشید و 100 مقاله را بدون هزینه دیگری دریافت کنید.

برای پرداخت حق اشتراک اگر عضو هستید وارد شوید در غیر این صورت حساب کاربری جدید ایجاد کنید

عضویت
فهرست مطالب نویسنده:

محمود نظری

  • محمود نظری*، زینب علی پور، سپیده رستمی، غزال محمدی اهوازی
    هدف

    عنصر روی یکی از محدودکننده ترین ریزعناصر معدنی است که برای رشد بدن، ساختمان و فعالیت هورمونی و آنزیمی، سوخت و ساز مواد مغذی، تقسیم سلولی و سیستم ایمنی مورد نیاز است. مشخص شده که کمبود روی با کاهش مصرف غذا، کاهش رشد و کاهش تولید IGF-1 در کبد همراه است. عنصر روی یکی از عوامل مهم در تنظیم بیان ژن خانواده IGF در بسیاری از بافت ها است. همچنین عنصر روی بر غیر اشباع سازی اسید لینولئیک موثر است. عنصر روی می تواند از پراکسیداسیون لیپیدها جلوگیری کند. به طور کلی ارتباط قابل توجهی بین متابولیسم چربی و عنصر روی وجود دارد. از طرف دیگر روغن کتان حاوی اسیدچرب ضروری آلفالینولینک اسید (امگا3) است که به نظر می رسد با عملکردهای IGF-1 در بدن مرتبط باشد. لذا در این پژوهش تاثیر افزودن مکمل آلی روی-متیونین به جیره های با و بدون مکمل نمک کلسیمی روغن کتان بر بیان ژن IGF-1 در بافت کبد بره های نر پرواری مورد بررسی قرار گرفت.

    مواد و روش ها

    در این پژوهش از 44 راس بره نر عربی با آزمایش فاکتوریل 2*2 در قالب طرح کاملا تصادفی با چهار تیمار و 11 تکرار استفاده شد. چهار جیره ی آزمایشی عبارت بودند 1) جیره پایه بدون مکمل نمک کلسیمی روغن کتان و بدون مکمل روی- متیونین (کنترل)، 2) جیره پایه بدون مکمل کلسیمی روغن کتان حاوی 08/0 درصد مکمل روی- متیونین (معادل 100 میلی گرم روی در کیلوگرم ماده خشک، 3) جیره پایه حاوی 3 درصد مکمل نمک کلسیمی روغن کتان بدون مکمل روی-متیونین ، 4) جیره پایه حاوی 3 درصد مکمل نمک کلسیمی روغن کتان بعلاوه 08/0 درصد مکمل روی-متیونین. پس از پایان دوره پروار 3 راس گوسفند از هر تیمار کشتار گردید و بافت کبد همراه با ازت مایع به آزمایشگاه منتقل شد. پس از استخراج RNA و اندازه گیری کیفیت آن، سنتز cDNA انجام شد. در نهایت میزان بیان ژن IGF-1 با استفاده از روش Real time PCR مورد ارزیابی قرار گرفت.

    نتایج

    مشاهده تک باند در محدوده ی 240 جفت نوکلئوتید برای ژن IGF-1 و در محدوده ی 144 جفت نوکلئوتید برای ژن GAPDH بر روی الکتروفورز ژل، بیانگر صحت انجام آزمایش و تکثیر قطعه ی مورد نظر بوسیله واکنش زنجیره ای پلیمراز بود. حضور تنها یک قله در منحنی های ذوب ژن IGF-1 و GAPDH در واکنش Real time PCR تولید یک محصول اختصاصی در این واکنش را تایید کرد. نتایج حاصل از این پژوهش نشان داد، افزودن مکمل روی منجر به افزایش معنی دار بیان ژن IGF-1 شده (01/0 >P)، به طوری که از 1 به 95/4 رسیده است. همچنین اثر افزودن مکمل چربی نمک کلسیمی روغن کتان بر بیان ژن IGF-1 معنی دار یوده (01/0 >P) به طوری که از 1 به 52/3 رسیده است. اثرات متقابل مکمل روی- متیونین و مکمل چربی نمک کلسیمی روغن کتان معنی دار نشد. افزودن همزمان مکمل روی- متیونین و مکمل چربی نمک کلسیمی روغن کتان به جیره بره های پرواری سبب افزایش بیان ژن IGF-1 در کبد می گردد.

    نتیجه گیری

    افزودن مکمل آلی روی-متیونین به جیره های حاوی مکمل چربی نمک کلسیمی روغن کتان سبب افزایش بیان ژن IGF-1 می گردد. افزایش بیان ژن IGF-1 در کبد احتمالا منجر به افزایش رشد و در نهایت تولید دام خواهد شد.

    کلید واژگان: بیان ژن، عنصر روی، روغن کتان، فاکتور رشد شبه انسولین
    Mahmood Nazari *, Zeinab Alipoor, Sepideh Rostami, Ghazal Mohamadi Ahvazi
    Objective

    Zinc is one of the most limiting trace mineral elements required for body growth, structure, hormonal and enzyme activity, nutrient metabolism, cell division, and immune system function. Zinc deficiency has been associated with reduced food intake, stunted growth, and decreased production of IGF-1 in the liver. Zinc plays a key role in the regulation of IGF family gene expression in various tissues and is also effective in desaturating linoleic acid, thereby preventing lipid peroxidation. There is a significant relationship between fat metabolism and zinc. On the other hand, flaxseed oil contains the essential fatty acid alpha-linolenic acid (omega-3), which appears to be related to IGF-1 function in the body. Therefore, this research investigated the effect of adding a zinc-methionine organic supplement to diets with and without the calcium salt of flaxseed oil on IGF-1 gene expression in the liver tissue of fattening lambs.

    Materials and Methods

    In this research, 44 Arab male lambs were used in a 2 x 2 factorial experiment within a completely randomized design, with four treatments and 11 replications. The four experimental diets were: 1) basic diet without Ca-salt of flaxseed oil supplement and without zinc-methionine supplement (CON), 2) basic diet without Ca-salt of flaxseed oil supplement containing 0.08% zinc-methionine supplement, 3) basic diet containing 3% Ca-salt of flaxseed oil supplement without zinc-methionine supplement, and 4) basic diet containing 3% Ca-salt of flaxseed oil supplement plus 0.08% zinc-methionine supplement. After the fattening period, three lambs from each treatment were slaughtered, and muscle tissue was transferred to the laboratory with liquid nitrogen. After RNA extraction and quality assessment, cDNA synthesis was performed. The expression of lipogenic genes was evaluated using the Real-time PCR method.

    Results

    The presence of a single band in the range of 240 base pairs for the IGF-1 gene and 144 base pairs for the GAPDH gene on gel electrophoresis confirmed the accuracy of the test and the correct amplification of the desired fragments by polymerase chain reaction. The presence of a single peak in the melting curves of the IGF-1 and GAPDH genes in the real-time PCR reaction further confirmed the specificity of the produced products. The results showed that the addition of zinc supplements significantly increased the expression of the IGF-1 gene (P < 0.01), from 1 to 4.95. Additionally, the calcium salt of flaxseed oil supplement significantly increased IGF-1 gene expression (P < 0.01), raising it from 1 to 3.52. The interaction effects of the zinc-methionine supplement and calcium salt flax oil supplement were not significant. Simultaneous addition of the zinc-methionine supplement and the calcium salt flax oil supplement to the diet of fattening lambs increased IGF-1 gene expression in the liver.

    Conclusions

    The addition of a zinc-methionine organic supplement to diets containing a calcium salt flaxseed oil supplement increases IGF-1 gene expression. Increasing IGF-1 gene expression will likely enhance growth and overall production.

    Keywords: Flaxseed Oil, Gene Expression, IGF-1, Zinc
  • سپیده رستمی، محمدتقی بیگی نصیری، محمود نظری*، محسن چراغی زاده
    مطالعه حاضر به منظور بررسی امکان سنجی تعیین جنسیت جنین مرغ بومی ایران با استفاده از طیف سنجی رامان انجام شد. تعیین جنسیت جنین ها با استفاده از طیف سنجی رامان با طول موج  nm785 در روز 5/3 انکوباسیون انجام گرفت. صحت سنجی این روش با استفاده از روش واکنش زنجیره ای پلیمراز مورد بررسی قرار گرفت. طیف های به دست آمده از طیف سنج رامان با استفاده از نرم افزار Origin رسم شده و مورد تجزیه و تحلیل قرار گرفتند. شاخص های اصلی مورد استفاده جهت تجزیه و تحلیل طیف رامان، شدت اوج های رامانی و نسبت شدت اوج های غالب بودند. در واکنش زنجیره ای پلیمراز، یک قطعه به طول 461 جفت باز برای جنین های با جنسیت نر (ZZ) و دو قطعه با طول های 461 و 322 جفت باز برای جنین هایی با جنسیت ماده (ZW) تکثیر شد. نتایج طیف سنجی نشان داد شدت باندهای رامانی در جنسیت های مختلف متفاوت است، به طوری که شدت باندهای رامانی در جنس نر، بیشتر و در جنس ماده، کمتر بود. بنابراین، تغییرات شدت طیف های رامان را می توان ملاک تشخیص جنسیت قرار داد. همچنین، نتایج حاصل از رسم نمودار شمعی داده ها به صورت تجمعی نشان داد که مقادیر میانه و میانگین در هر دو نسبت برای جنسیت نر دارای مقدار بزرگتری در مقایسه با جنسیت ماده بود. با توجه به نتایج به دست آمده، این گونه استنباط می شود که طیف سنجی رامان می تواند به عنوان روشی مناسب جهت تعیین جنسیت جنین مرغ طی مراحل جوجه کشی مورد استفاده قرار گیرد و به دلیل کوتاه بودن زمان انجام آزمایش می تواند بهترین شرایط را برای استقرار در صنعت فراهم کرده و جنسیت را با دقت بالا مشخص نماید.
    کلید واژگان: تعیین جنسیت، جنین مرغ، طیف سنجی رامان، واکنش زنجیره ای پلیمراز
    S. Rostami, M. T. Beigi Nassiri, M. Nazari *, M. Cheraghizadeh
    Introduction
    The sex of chickens considerably impacts production performance and economic benefits in poultry farming. Male birds cannot lay eggs and usually have a lower ratio of meat to feed than broilers. Male chicks are typically killed immediately after hatching since they are redundant in the industry and male chicks will neither be suitable for egg production nor meat production. Day-old male chicks in the laying hen industry are usually culled immediately after hatching. As a result, this issue has caused moral concerns in societies. Efforts are underway to develop technology for automatically determining the sex of chick embryos, aimed at establishing a stable and efficient poultry farming system. In large commercial hatcheries, the sexing of newly born chicks is generally accomplished by three different methods according to new hatching lines' vent, color, or feathers. However, these methods are still time- and labor-consuming. If sex can be identified at an early embryonic stage or even before incubation, male eggs could be used as feed components. Moreover, fewer eggs would need to be incubated, which would reduce feed space requirements, CO2 emissions, and energy consumption, which are all economically beneficial to farmers and the environment. In recent decades, researchers have used various in ovo sexing strategies in chicken eggs before hatching or incubation. Some invasive and noninvasive studies that have been conducted for in ovo sexing of chicken eggs can be divided into five major categories: (i) molecular-based techniques, (ii) spectral-based techniques (Raman spectroscopy, fluorescent, 3D X-ray), (iii) acoustic-based techniques, (iv) morphology-based techniques, and (v) volatile organic compound (VOC)-based techniques. Commercially applicable methods must be noninvasive, rapid enough for real-time applications, economically feasible, and ethically acceptable. An alternative method, to prevent the removal of day-old chicks, is a non-invasive method to determine the sex of the egg in the early stages of hatching before the development of the nervous system. Recently, Raman spectroscopy was reported to determine the sex of eggs at the incubation stage. Raman spectroscopy is based on the Raman effect, whereby when incident light (wavelength 750–850 nm) excites molecules in a tissue, the molecules reflect light at a different wavelength. The reflected light's wavelength is characteristic of various chemical components and allows the detection of the atheromatous plaque chemical synthesis. Raman spectroscopy is a powerful tool expected to revolutionize chick sex determination because it can provide information about biological molecules. Thus, Raman spectroscopy is suitable for analyzing living organisms, leading to its widespread adoption across various biological and medical applications. Therefore, resonance Raman spectroscopies have found application in blood analysis, with some studies exploring its utility in chick sexing. For this purpose, the present study was carried out to investigate the feasibility of determining the sex of Iranian native chicken embryos using the Raman spectroscopy.
    Materials and methods
    To carry out this research, 100 fertilized eggs of Iranian native chickens were used. The sex of the embryos was determined using Raman spectroscopy with a wavelength of 785 nm during the fourth day of incubation. Validation of this method was investigated using the polymerase chain reaction (PCR) technique. Sequence alignment of CHD-Z and CHD-W allele sequences amplified by PCR technique. The amplified DNA fragments were single and double DNA bands in the size of 461 bp for the CHD-Z and 322 bp for the CHD-W genes. The PCR was carried out using a PCR master kit with specific primers (the forward primer: 5′- TATCGTCAGTTTCCTTTTCAGGT -3′, the reverse primer: 5′- CCTTTTATTGATCCATCAAGCCT -3′). Thermal cycling conditions for DNA amplification were: 1 cycle of initial denaturation at 94°C for 5 minutes; 35 cycles comprising 30s at 94°C for the denaturation, 30s at 59°C for annealing, 30s at 72°C for the elongation; and a final extension cycle at 72°C for 5 minutes. The PCR products were analyzed by electrophoresis on 2.5% agarose gel against a DNA Ladder 100bp, and visualized using the safe staining on UV transilluminator. The data obtained from the Raman spectrometer was analyzed using the Origin software. The main indices used to study the data were the intensity of the Raman peaks and the ratio of the dominant peak intensity. Additionally, principal component analysis (PCA) was employed to identify any patterns in the data. To calculate PCA1 and PC2, the ratios of I769/I838 and I1141/I1251 peaks were considered, respectively. PCA analysis can choose features that have a greater impact on the final result, depending on the data and the scope of their changes.
    Results and discussion
    The result of PCR showed that one fragment with a length of 461 bp was amplified for male embryos (ZZ) and two fragments with lengths of 461 and 322 bp were amplified for female embryos (ZW(. The study found that there are differences in the intensity of Raman bands between genders. Males have higher intensity while females have lower intensity. Therefore, changes in Raman spectra intensity can be used to identify gender. Additionally, the candlestick chart of the data showed that median and average values for males were larger than for females. Furthermore, the results obtained from PCA analysis showed that the variance percentages for PC1 and PC2 were 53.69% and 46.31%, respectively. PC2 is more reliable as it has less deviation.
    Conclusions
    Based on the results obtained from the study, it can be concluded that Raman spectroscopy is a reliable method for determining the gender of chicken embryos during incubation. This test is quick, accurate, and can be easily incorporated into the industry to determine the gender of embryos without resorting to the practice of killing day-old chicks. Not only is this method more ethical, but it also offers a high level of accuracy, making it an attractive alternative for the industry. In general, these results demonstrate the potential application of hematological traits in developing an automatic in ovo embryo sexing method through spectroscopic analysis.
    Keywords: Sex Determination, Chicken Embryo, Raman Spectroscopy, Polymerase Chain Reaction
  • مریم پناهی زاده، محمدتقی بیگی نصیری، محمود نظری*، جمال فیاضی

    در این تحقیق، به منظور بررسی اثر توارث سیتوپلاسمی برصفات رشد، از تعداد کل 19717 رکورد مربوط به گوسفندان عربی استفاده گردید. با دنبال کردن لاین های سیتوپلاسمی از نتاج به والد مبنا، منابع اولیه سیتوپلاسمی مشخص شد. نرم افزار آماری SAS جهت تعیین عوامل محیطی موثر بر این صفات و از نرم افزار MTGSAM جهت برآورد پارامترهای ژنتیکی، با روش آماری بیزی مورد استفاده قرار گرفت. اثرات ثابت شامل جنس ، تیپ تولد ، سن مادر و سال تولد در سطح (01/0 <p) معنی دار به دست آمد. در روش آمار بیزی براساس کمترین میزان معیار آکائیک بهترین مدل ها برای صفات وزن تولد، سه ماهگی، شش ماهگی، نه ماهگی و یکسالگی به ترتیب مدل های 5 ، 5 ، 3 ، 4 ، 3 بودند. مقدار توارث سیتوپلاسمی به دست آمده برای وزن تولد، سه ماهگی به ترتیب برابر با 02/ 0و 03/0 و برای وزن شش ماهگی، نه ماهگی و یکسالگی توارث سیتوپلاسمی مشاهده نشد. همچنین مقدار واریانس سیتوپلاسمی مشاهده شده برای وزن تولد و وزن سه ماهگی در گوسفندان عربی به ترتیب برابر با 004/0 و 41/0 و برای وزن شش ماهگی تا یکسالگی واریانس سیتوپلاسمی مشاهده نگردید. به طور کلی اگرچه برای صفت وزن سهم اثر توارث سیتوپلاسمی کم بود اما منظور نمودن اثرات مادری و اثر توارث سیتوپلاسمی باعث برآورد دقیق تری از پارامترهای ژنتیکی صفات رشد بدن در تمام سنین خواهد شد.

    کلید واژگان: روش بیزی، گوسفند عربی، صفات رشد، سیتوپلاسم
    Maryam Panahizadeh, Mohammadtaghi Beiginasiri, Mahmood Nazari *, Jamal Fayazi

    In order to evaluate cytoplasmic inheritance of growth traits (including birth weight, 3, 6, 9 and 12 month weight), the total number of 19717 Arabic sheep records which was collected by Agricultural Organization of Khuzestan province was used during1989 to 2010. Following the cytoplasmic lines from progeny to the parents, cytoplasmic primary sources were identified. Environmental factors affecting these traits were analyzed by SAS statistical software. Genetic parameters were estimated using Bayesian statistical method and MTGSAM software. Significant effect (P <0.01) on traits including lambs sex, birth type, maternal age and birth year were found. Based on the lowest acacia criteria in Bayesian statistical method, models 5, 5, 3, 4, 3 for birth weight, 3, 6, 9 and 12 months were the best models respectively. The cytoplasmic inheritance for birth weight, 3 months of age was 0.02, 0.03, and for the weights at 6, 9 and 12 months age, there was no cytoplasmic inheritance. However, the observed cytoplasmic variance for birth weight and 3 months old weight in Arab sheep were 0.004, 0.410, respectively, while no cytoplasmic variance for 6 to 12 months old was observed. Generally, although for the weight trait the share of cytoplasmic inheritance was low, but considering maternal effects and cytoplasmic heritages would result in a more accurate estimation of the genetic parameters of the growth traits of all ages.

    Keywords: Bayesian Method, Arabic Sheep, Growth Traits, Cytoplasmic
  • محمود نظری*، هدایت الله روشنفکر، فاطمه ثعلبی، جمال فیاضی، علی محمدیان، فریبا کاوش
    مقدمه و هدف

    زهر زنبور عسل ترکیبی مایع، بیرنگ و اسیدی (pH 4.5-5.5) است که شامل 18 ترکیب متفاوت مانند آنزیم ها، پپتیدها و آمینه ای زیستی می باشد. برخی از این ترکیبات دارای خواص ضد التهابی و برخی دارای خواص سمی و آلرژن می باشد. مهم ترین پپتیدهای موجود در زهر زنبور ملیتین، آپامین، آدولاپین و پپتید دگرانوله کننده ماست سل هستند. مهمترین آنزیم های موجود در زهر زنبور می توان هیالورونیداز و فسفولیپاز A2 را نام برد. زهر زنبور عسل در ادوار گذشته بخصوص در درمان سنتی همواره به‎ عنوان دارو در درمان بیماری ‎های مختلفی مانند آرتریت روماتویید و همچنین جهت کاهش دردهای عضلانی مورد استفاده قرار گرفته است. زنبورگزیدگی به ‎عنوان یکی از مشکلات در سیستم بهداشت عمومی برخی از کشورهای دنیا از جمله ایران مطرح می باشد. در حال حاضر درمان خاصی برای زنبور گزیدگی وجود ندارد و درمان تا حدودی توسط داروهای شیمیایی انجام می شود. در سال های گذشته پادزهر مبتنی بر Fab از اسب و گوسفند به‎ عنوان یک درمان جدید بالقوه مطرح شده است. تاکنون در ایران اقدامی جهت تولید آنتی ونوم (پادزهر) برای نجات افراد حساس به نیش زنبور صورت نگرفته است. لذا هدف از این تحقیق تولید پادزهر سرم اسبی موثر و ایمن در مقابل زنبور عسل ایرانی (Apis mellifera meda) بود. 

    مواد و روش‎ها:

     زهر خام از زنبور عسل ایرانی به‎وسیله دستگاه زهرگیر تهیه گردید. زهر در مجاورت هوا سریعا خشک می شود. زهر خشک شده هر روز به‎ کمک کاردک های مخصوص از روی صفحات شیشه ای جمع ‎آوری و برای استفاده بعدی در شیشه های تیره رنگ در فریزر 20- درجه سانتی گراد ذخیره گردید. به‎ هنگام استفاده از سم، برای حذف موکوس و مواد اضافه، سم به نسبت 1 به 1 با محلول سالین (سرم فیزیولوژی) حل شده و با دور بالا سانتریفیوژ می گردد. بعد از سانتریفیوژ محلول شفاف بالایی جدا و با فیلتر 0/2 میکرون فیلتر می گردد. مقدار پروتئین موجود در محلول زهر خام، به ‎روش پروتئین سنجی برادفورد و بر اساس منحنی استاندارد حاصل از سنجش غلظت های مختلف محلول سرم آلبومین گاوی (BSA) تعیین شد. مقدار متوسط دوز کشندگی (LD50) با 24 موش سوری نر تعیین گردید. موش ها به گروه های 4 تایی تقسیم شدند و 0/5 میلی لیتر از دوزهای مختلف زهر (60، 70، 80، 90، 100 و 110 میکروگرم در میلی لیتر) محلول در نرمال سالین استریل به‎ صورت داخل وریدی به آنها تزریق شد. به موش های شاهد 0/5 میلی لیتر محلول نمکی تزریق شد. مرگ و میر پس از 24 ساعت ثبت شد و LD50 بر اساس آنالیز پروبیت محاسبه گردید. در این پژوهش از 3 اسب مادیان بالغ 3 ساله (400 تا 450 کیلوگرم) استفاده گردید. برای ایمن سازی اسب ها زهر زنبور به همراه ادجوانت فروند کامل و ناقص تزریق گردید. در تلقیح اول و دوم از ادجوانت فروند کامل و در تلقیح های بعدی از ادجوانت فروند ناقص استفاده شد. تلقیح سم به صورت افزایشی به ترتیب از 50، 100، 250، 500، 1000، 2000 و 4000 میکروگرم در طی 7 مرتبه با فواصل زمانی 7 روز اجرا شد. تزریق به صورت زیر پوستی (گردن) انجام شد. جداسازی آنتی بادی اسب با پروتکل استاندارد روش آمونیوم سولفات اشباع شده اجرا شد. ارزیابی ایمنی زایی در شرایط آزمایشگاهی  با تست الایزا انجام گرفت. سرم اسب های ایمن شده و نیز آنتی ونوم حاصل از رسوب آمونیوم سولفات اشباع از نظر خنثی سازی سم ارزیابی شدند. جهت بررسی کیفیت پادزهر، خنثی سازی فعالیت فسفولیپاز A2 با استفاده از غلظت های مختلف پادزهر اجرا شد. در نهایت متوسط دوز موثر (ED50) برای پادزهر در موش سوری تعیین گردید. برای تعیین کارآیی پادزهر اسبی تهیه شده، زهر زنبور به‎صورت دوز افزایشی با مقدار ثابت پادزهر مخلوط و به موش تزریق شد.

    یافته‎ ها: 

    مقدار LD50 برای زهر زنبور 4/84 میکروگرم برای هر گرم وزن زنده موش به‎دست آمد. نتایج تست الیزا نشان داد که روند پاسخ اسب ها نسبت به زهر افزایشی بوده و به‎ خوبی با آنتی ژن ایمن شده‎اند. خنثی سازی فعالیت فسفولیپاز A2 با استفاده از غلظت های مختلف پادزهر نشان داد که سم زنبور عسل ایرانی دارای فعالیت فسفولیپازی است و 120 میکروگرم در میلی لیتر از این پادزهر قادر به خنثی کردن کامل فعالیت سم فسفولیپاز A2 است. از این داده ها مشخص است که اولا سم زنبور عسل ایرانی دارای فعالیت فسفولیپازی است و دوما 55 میکروگرم پادزهر برای خنثی کردن 50 درصدی فعالیت فسفولیپاز A2 در 100 میکروگرم زهر مورد نیاز است. مقدار ED50 تقریبا 54 برابر LD50 خواهد شد. این بدان معنی است که پادزهر تا 54 برابر LD50 را می تواند خنثی کند. بنابراین مرگ ایجاد شده بوسیله 4 میلی گرم سم زنبور با 1 میلی لیتر پادزهر خنثی می شود به‎ همین دلیل میزان متوسط دوز موثر ED50 برابر با 4 میلی گرم بر میلی لیتر خواهد بود. اگر در هر بار نیش زنبور مقدار 100 میکروگرم زهر وارد بدن شود پس 1 میلی لیتر از این پادزهر می تواند 40 نیش زنبور را خنثی کند.

    نتیجه گیری

    پادزهر سرم اسبی که علیه سم زنبور عسل ایرانی به‎دست آمد، در مدل حیوانی قادر به خنثی سازی سم بوده و از مرگ موش‎هایی که با سم تلقیح شده بودند جلوگیری می نماید.

    کلید واژگان: اسب، پادزهر، زنبور عسل ایرانی
    Mahmood Nazari*, Hedaiatolah Roshanfekr, Fatemeh Salabi, Jamal Fayazi, Ali Mohamadian, Fariba Kavosh
    Introduction and Objective

    Bee venom is a liquid, colorless and acidic mixture (pH 4.5-5.5) that contains 18 different compounds such as enzymes, peptides and biological amino acids. Some of these compounds have anti-inflammatory properties and some have toxic and allergenic properties. Bee venom is produced by female worker bees. The most important peptides in bee venom are melittin, apamin, adolapin and mast cell degranulating (MCD) peptide. The most important enzymes in bee venom can be called hyaluronidase and phospholipase A2 (PLA2). Bee venom has been used in the past, especially in traditional medicine, as a medicine to treat various diseases such as rheumatoid arthritis and also to reduce muscle pain.Massive bee attacks are considered one of the Public Health problems in some countries in the world, including Iran. No specific therapy is available for bee stings and the treatment is done by chemical drugs, leading us to develop Fab-based antivenom as a potential new treatment. So far in Iran, no action has been taken to produce Fab-based antivenom to save people who are sensitive to bee stings. Therefore, the aim of this research was to produce an effective and safe horse serum antidote against the Iranian honey bee (Apis mellifera meda).

    Material and Methods

    Crude bee venom (BV) was prepared from Iranian bees (Apis mellifera meda) using an electric bee venom collecting machine. The poison dries quickly in the air. The dried venom was collected from the glass plates every day with the help of special spatulas and stored in dark glasses in a freezer at -20 ºC for future experiments. To remove mucus and extra substances, the poison is dissolved in a ratio of 1:1 with saline (physiological serum) and centrifuged at high speed. After centrifugation, the upper clear solution is separated and filtered with a 0.2 micron filter.The amount of protein in the crude venom solution was determined by the Bradford protein assay method and based on the standard curve obtained by measuring different concentrations of bovine serum albumin (BSA) solution.The median lethal dose (LD50) value of BV was determined with 24 male mice. Mice were divided into 4 groups. Then 0.5 ml of different doses of venom (60, 70, 80, 90, 100 and 110 μg/ml) dissolved in sterile normal saline were injected intravenously. Control group were injected with 0.5 ml saline solution. Mortality was recorded after 24 hours and LD50 was calculated based on probit analysis. In this research, 3 horses were used to produce antivenom against honey bee venom. For this purpose, horses were immunized with Iranian bee venom 7 times with 7-day intervals, and immunogenicity was evaluated in laboratory conditions with ELISA test. The precipitated antivenom with saturated ammonium sulfate was also used to perform the neutralizing test in mice. To check the quality of antivenom, the neutralization of phospholipase A2 activity was performed using different concentrations of antivenom. Finally, for determining the efficiency of the prepared antivenom, the median effective dose (ED50) value was calculated by probit analysis. In this research, three adult mares (three years old, 400 to 450 kg) were used. To immunize the horses, bee venom was injected with complete and incomplete Freund's adjuvant. Complete Freund's adjuvant was used in the first and second inoculations, and incomplete Freund's adjuvant was used in subsequent inoculations. Venom inoculation was carried out incrementally from 50, 100, 250, 500, 1000, 2000 and 4000 micrograms in 7 times with 7 days intervals. The injection was done subcutaneously (in the neck). Isolation of horse antibody was performed with the standard protocol of the saturated ammonium sulfate method. Evaluation of immunogenicity in laboratory conditions was done by ELISA test. The serum of immunized horses and the precipitated antivenom with saturated ammonium sulfate were was also used to perform the neutralizing test in mice. To check the quality of antivenom, the neutralization of phospholipase A2 activity was performed using different concentrations of antivenom. Finally, for determining the efficiency of the prepared antivenom, the median effective dose (ED50) value was calculated by probit analysis. To determine the effectiveness of the prepared horse antivenom, bee venom was mixed with a constant amount of antivenom in increasing doses and injected into mice

    Results

    The total protein in the crude BV solution was calculated to be 56 mg/ml. Also, the LD50 of the crude BV was obtained as 4.84 μg/g. ELISA test results showed an immune response that increased more during the immunization schedule. Neutralization of phospholipase A2 activity using different concentrations of antivenom showed that Iranian bee venom has phospholipase activity and 120 μg/ml of this antidote is able to completely neutralize the activity of phospholipase A2. It is clear that, firstly, Iranian honey bee venom has phospholipase activity, and secondly, 55 micrograms of antivenom are needed to neutralize 50% of phospholipase A2 activity in 100 micrograms of venom.The ED50 value will be approximately 54 times the LD50. This means that the antivenom can neutralize up to 54 times the LD50. Therefore, the death caused by 4 mg of bee venom is neutralized by 1 ml of antivenom, so the average effective dose ED50 will be 4 mg/ml. If 100 micrograms of venom enters the body in each bee sting, then 1 ml of produced antivenom can neutralize 40 bee stings.

    Conclusion

    The result showed that horse antivenom against honey bee venom is capable to neutralize the crude venom in mice model.

    Keywords: Antivenom, Equine, Iranian honey Bees
  • غزال محمدی اهوازی، محمدتقی بیگی نصیری، محمود نظری*، آیه سادات صدر

    این پژوهش به منظور شناسایی و اعتبارسنجی نشانگرهای توالی ساده تکراری (SSR) مربوط به گونه ماهی گطان (Luciobarbus xanthopterus) با استفاده از داده های RNA-Seq انجام شد. پس از جداسازی بافت کبد، استخراج RNA از نمونه ها انجام گرفت. نمونه ها با استفاده از پلتفرم ایلومینا Novaseq 6000 توالی یابی شدند. برای بازسازی رونوشت ها، از نرم افزار Trinity (نسخه 2.15.1) استفاده شد. شناسایی SSRs با استفاده از از پایگاه MISA انجام شد. پرایمرهای مورد نیاز در واکنش زنجیره ای پلیمراز برای 5 نشانگر SSR با نرم افزار PRIMER 3 طراحی و بر 45 ماهی گطان مورد ارزیابی قرار گرفت. سرهم بندی رونوشت ها با برنامه Trinity، 941،894 یونی ژن و 1،768،662 ترانسکریپت ایجاد کرد. در این مطالعه، بررسی 1،276،825 توالی به وسیله نرم افزار MISA، منجر به شناسایی تعداد 349،871 نشانگر SSR شد. در میان SSRs ، تکرارهای دو و سه نوکلئوتیدی به ترتیب با 37/89 درصد و 05/8 درصد، بیشترین تعداد تکرار را به خود اختصاص دادند. 5 پرایمر مورد استفاده، 2 جایگاه چندشکلی را نشان دادند. هتروزیگوسیتی مورد انتظار و مشاهده شده برای جایگاه MN1359 به ترتیب 785/0 و 147/0 و برای جایگاه GM1371 به ترتیب 770/0 و 093/0 محاسبه شد. به علاوه، آزمون کای مربع نشان داد که جمعیت برای هر دو جایگاه در تعادل هاردی-‏وینبرگ قرار ندارد. نتایج ارزیابی معیار های مختلف تنوع ژنتیکی همگی گویای کاهش تنوع در بین جمعیت مورد مطالعه بود. به طور کلی، نتایج این تحقیق نشان داد که SSRs جدید می توانند برای اصلاح نژاد، مطالعات ژنومیک عملکردی و بررسی تنوع ژنتیکی ماهی گطان مفید باشند.

    کلید واژگان: گطان، RNA-Seq، ترانسکریپتوم، توالی های ساده تکراری
    Ghazal Mohamadi Ahvazi, Mohamadtaghi Beigi Nassiri, Mahmood Nazari*, Ayah Sadat Sadr

    This research was conducted to identify and validate the simple sequence repeats (SSR) markers related to yellowfin barbel (Luciobarbus xanthopterus) using RNA-Seq data. After collecting the liver tissue, RNA was extracted from the samples. The samples were sequenced using the Illumina Novaseq 6000 platform. Trinity software (version 2.15.1) was used to reconstruct transcripts. Identification of SSR was done using the MISA web server. The primers needed in the polymerase chain reaction for 5 SSR markers were designed by PRIMER 3 software and validated using 45 yellowfin barbel. Transcript assembly by the Trinity program generated 941,894 unigenes and 1,768,662 transcripts. In this study, the examination of 1,276,825 sequences by MISA software led to the identification of 349,871 potential SSR markers. Among the SSRs, di- and trinucleotide repeats had the highest number of repetitions with 89.37% and 8.05%, respectively. From the 5 primers used, only two of them showed polymorphism. The expected and observed heterozygosity for the MN1359 locus were calculated as 0.785 and 0.147, and for the GM1371 locus given 0.770 and 0.093, respectively. Moreover, the chi-square test showed that population was not in Hardy-Weinberg equilibrium. The results of different genetic diversity criteria showed a decrease in diversity in yellowfin barbel. Generally, this research showed that the new SSRs can be helpful for molecular breeding, functional genomics studies, and the genetic diversity analysis of yellowfin barbel.

    Keywords: Yellowfin Barbel, RNA-Seq, Transcriptome, Simple Sequence Repeats
  • حدیث میرزایی، علی آقایی*، الهام حویزی، محمود نظری
    مقدمه و هدف

    اسید آلفا لیپوئیک (α-LA) به‎صورت آنزیمی در میتوکندری از اسید اکتانوئیک سنتز می ‏شود. سطح درون ‏زا α-LA در محدوده میکرومولار گزارش شده است. اسید آلفا لیپوئیک به‎ دلیل خاصیت چربی دوستی بالا می‏ تواند به ‎راحتی از غشای‏ های بیولوژیکی عبور کند و در سلول‏ ها به اسید دی هیدرولیپوئیک (DHLA) تبدیل ‏شود. اسید آلفا لیپوئیک و DHLA را به ‏عنوان یک زوج آنتی‏اکسیدان ایده آل توصیف کرده اند، زیرا توانایی محافظت بسیار بالایی در برابر استرس اکسیداتیو از طریق مسیرهای متعدد دارند. اسید آلفا لیپوئیک و DHLA دارای فعالیت کلا‏ت‏ کننده فلز هستند، به ‏عنوان یک کوآنزیم در متابولیسم گلوکز عمل می‏ کنند و می‏ توانند آنتی ‏اکسیدان‏ های دیگر مانند آسکوربات، ویتامین E و گلوتاتیون (GST) تولید کنند. اسید آلفا لیپوئیک دارای خواص ضدالتهابی است و افزودن آن به جیره جوجه‏ های گوشتی بیان نسبی ژن‏ های مرتبط با التهاب را بهبود می بخشد. از طرف دیگر، کروم سه ظرفیتی یک عنصر کمیاب ضروری شناخته شده در انسان و سایر حیوانات می ‏باشد که جز فاکتور تحمل گلوکز (GTF) است. کروم برای متابولیسم کربوهیدرات ‏ها، پروتئین‏ ها و لیپیدها ضروری است. کروم ممکن است در جیره به شکل ترکیبات معدنی یا کمپلکس‏ های آلی وجود داشته باشد. پس از جذب، کروم در حالت آزاد گردش می ‏کند و به ترانسفرین یا سایر پروتئین‏ های پلاسما (پروتئین b-گلوبولین) متصل می ‏شود. به ‏نظر می‏رسد کروم سه ظرفیتی در ساختار و بیان اطلاعات ژنتیکی در حیوانات نقش داشته باشد. اتصال کروم به اسیدهای نوکلئیک قوی ‏تر از سایر یون‏ های فلزی است. کروم از RNA در برابر دناتوره شدن حرارتی محافظت می‏ کند. همچنین واضح است که کروم در هسته سلولی متمرکز است. کروم با اتصال به کروماتین در بیان ژن شرکت می ‏کند و باعث افزایش مکان‏ های شروع و در نتیجه افزایش سنتز RNA می‏ شود. این افزایش به‎ دلیل القای پروتئین متصل به هسته و فعال شدن کروماتین هسته ‏ای است در نتیجه کروم بر عملکرد ژن تاثیر می‏ گذارد. مکمل کروم در جیره تاثیر مثبتی بر پاسخ ایمنی جوجه‏ های گوشتی دارد. بنابراین در این تحقیق اثر مکمل های کروم و اسید آلفا لیپوئیک بر بیان ژن اینترلوکین 1، 2، 4 و 10، همچنین IFN-γ، TNF - α وTGF-β4  بافت طحال جوجه گوشتی مورد بررسی قرار گرفت.

    مواد و روش‎ها: 

    جهت انجام این آزمایش از 144 قطعه جوجه گوشتی یک روزه سویه راس 308 به ‎صورت فاکتوریل (3×2) در قالب طرح کاملا تصادفی با دو سطح اسید آلفالیپوئیک (صفر و 300 میلی‏ گرم بر کیلوگرم) و سه سطح پروپیونات کروم (صفر، 750 و 1500 میکرو‏گرم بر کیلوگرم) با 6 تیمار، 3 تکرار و 8 قطعه جوجه در هر تکرار استفاده شد. در پایان دوره آزمایش (42 روزگی)، دو قطعه جوجه از هر پن به ‏طور تصادفی انتخاب و کشتار شدند. نمونه از طحال گرفته شد و بلافاصله در نیتروژن مایع منجمد و سپس در 80- درجه سانتی ‏گراد ذخیره شد. بررسی کمیت و خلوص RNA استخراج شده با استفاده از دستگاه نانودراپ انجام شد. به منظور تایید تکثیر اختصاصی ژن های موردنظر در این مطالعه با استفاده از آغازگرها، ابتدا واکنش PCR انجام شد. بیان نسبی ژن های اینترلوکین 1، 2، 4 و 10، همچنین IFN-γ، TNF - α وTGF-β4  بافت طحال به ‎روش واکنش زنجیره ای پلیمراز در زمان واقعی ارزیابی شد. در این روش 28S به‎ عنوان ژن خانه دار جهت مقایسه نسبی داده ها استفاده شد. برای آنالیز داده ‏های به ‎دست آمده از روش اختلاف در تغییرات درجه آستانه (CT∆∆) استفاده شد. روش بررسی تغییرات بیان ژن در این پژوهش روش ΔΔCT-2 (آستانه مقایسه ‏ای) و نسبت به بیان ژن (s28) بود.

    یافته ها

    نتایج الکتروفورز بیان ژن ‏ها را در سلول های طحال مرغ های گوشتی تایید کرد و به‎ صورت یک باند روی ژل آگارز 2 درصد ظاهر شدند. الکتروفورز محصولات واکنش زنجیره ای پلیمراز به ‎ترتیب قطعات 86، 51، 82 و 88 جفت باز را برای اینترلوکین 1، 2، 4 و 10 نشان داد. برای ژن های IFN-γ، TNF - α و TGF-β4 باندی بر روی ژل آگارز تشکیل نشد. نتایج نشان داد بیان ژن‏ اینترلوکین 1 در گروه‏ دریافت کننده اسید آلفالیپوئیک (300 میلی‏ گرم بر کیلوگرم) نسبت به گروه شاهد به ‎طور معنی‏ داری کاهش یافته است. همچنین، بیان نسبی ژن‏ های اینترلوکین 1 و 4 در گروه‏ دریافت کننده سطح 1500 میکروگرم بر کیلوگرم پروپیونات کروم نسبت به گروه شاهد و گروه دریافت کننده 750 میکروگرم بر کیلوگرم پروپیونات کروم به ‎طور معنی‏ داری افزایش یافت. در حالی‎که افزودن اسید آلفالیپوئیک و پروپیونات کروم تاثیری بر بیان ژن‏ های اینترلوکین 2 و 10 نداشت.

    نتیجه گیری

    افزودن 300 میلی‏ گرم بر کیلوگرم اسید آلفالیپوئیک به جیره می تواند سبب بهبود پاسخ ایمنی ذاتی با کاهش بیان ژن اینترلوکین 1 در جوجه های گوشتی گردد. به‎علاوه، افزودن مقادیر بالای پروپیونات کروم (1500 میکروگرم) منجر به کاهش ایمنی (با افزایش بیان ژن اینترلوکین 1 و 4) می گردد. در حالی‎که افزودن پروپیونات کروم تا سطح 750 میکروگرم تاثیر بر ایمنی ندارد. با در نظر گرفتن نتایج، افزودن اسید آلفالیپوئیک در سطح 300 میلی‏ گرم به جیره جوجه های گوشتی توصیه می گردد. افزودن پروپیونات کروم تا سطح 750 میکروگرم در صورتی‎که اثرات مفیدی بر عملکرد و خصوصیات تولیدی داشته باشد بلامانع است.

    کلید واژگان: آلفالیپوئیک، بیان ژن، پاسخ ایمنی، کروم ​​​​​​​
    Hadis Mirzaei, Ali Aghaei*, Elham Hoveizi, Mahmoud Nazari
    Introduction and Objective

    Alpha-lipoic acid (α-LA) synthesized enzymatically in the mitochondrion from octanoic acid. Endogenous levels of α- lipoic acid have been reported in the micro molar range. Alpha-lipoic acid can easily pass through biological membranes due to its high lipophilicity and is converted into dihydro lipoic acid (DHLA) in cells. Alpha-lipoic acid and DHLA have been described as an ideal antioxidant couple, due to their very high protection ability against oxidative stress through multiple pathways. Alpha-lipoic acid and DHLA have metal chelating activity, acts as a coenzyme in glucose metabolism, and can produce other antioxidants such as ascorbate, vitamin E, and glutathione (GST). Alpha-lipoic acid has anti-inflammatory properties and its supplementation to broiler diets improves the expression of inflammation-related genes in the spleen. On the other hand, trivalent chromium has been recognized as an essential trace element for humans and other animals, which is part of the glucose tolerance factor (GTF). Chromium is essential for the metabolism of carbohydrates, proteins and lipids. Chromium may be present in the diet in the form of inorganic compounds or organic complexes. After absorption, chromium circulates in a free state and binds to transferrin or other plasma proteins (protein β-globulin). Trivalent chromium seems to play a role in the structure and expression of genetic information in animals. Chromium binding to nucleic acids is stronger than other metal ions. Chromium protects RNA against thermal denaturation. It is also clear that chromium is concentrated in the cell nucleus. By binding to chromatin, chromium participates in gene expression and increases the start sites and thus increases RNA synthesis. This increase is due to the induction of protein bound to the nucleus and the activation of nuclear chromatin, as a result, chromium effects gene function. Chromium supplementation has shown a positive effect on immune response of broiler chickens. The aim of this research was to investigate the simultaneous effect of dietary chromium propionate and alpha-lipoic acid supplementation on the expression of cytokines interleukin 1, 2, 4, and 10, as well as IFN-γ, TNF, and TGF β4 genes in the spleen tissue of broiler chickens.

    Material and Methods

    For this purpose, an experiment was performed with 144 Ross 308 broiler chicks in complete randomized design (CRD) with a 3×2 factorial arrangement of treatments including six treatments, 3 replicates and 8 chickens in each replicate. There were 6 dietary treatments: three doses of chromium propionate (0, 750 and 1500 μg / kg) combined with two levels of alpha-lipoic acid (0 and 300 mg/kg) supplemented to the basal diets. At the end of the experimental period (42 days old), two chickens from each pen were randomly selected and killed. The sample was taken from the spleen and immediately frozen in liquid nitrogen and then stored at -80°C. The quantity and purity of the extracted RNA was checked using a Nanodrop device. In order to confirm the specific amplification of the desired genes in this study using primers, the PCR reaction was first performed. The expression of cytokine profile genes were quantified by quantitative real time PCR. In this way, 28S was used as a house-keeping gene to normalize the gene expression data. To analyze the obtained data, the method of difference in threshold degree changes (∆∆CT) was used. The method of investigating gene expression changes in this research was the 2-ΔΔCT method (comparative threshold) and the ratio of gene expression (28s).

    Results

    The results of electrophoresis confirmed the expression of genes in the spleen cells of broiler chickens and they appeared as one band on 2% agarose gel. Electrophoresis of polymerase chain reaction products showed fragments of 86, 51, 82, and 88bp for interleukin 1, 2, 4, and 10, respectively. No bands were formed on agarose gel for IFN-γ, TNF and TGF β4 genes. The results showed that alpha-lipoic acid at the level of 300 mg/kg significantly decreased interleukin 1 gene expression than the control group (0 mg/kg). Also, supplementing the basal diet with the chromium propionate at the level of 1500 μg/kg significantly increased interleukin 1 and 4 genes expression compared to the control group and the chromium propionate at the level of 750 μg/kg. While the addition of alpha lipoic acid and chromium propionate had no effect on the expression of interleukin 2 and 10 genes.

    Conclusion

    Adding 300 mg/kg alpha lipoic acid to the diet can improve the immune response by reducing the expression of IL 1 gene in broilers. In addition, the addition of high amounts of chromium propionate (1500 μg) leads to a decrease in immunity (by increasing the expression of IL 1 and 4 genes). While the addition of chromium propionate up to the level of 750 μg/kg does not affect safety. Considering the results, it is recommended to add alpha lipoic acid at the level of 300 mg to the broiler diet. Addition of chromium propionate up to the level of 750 µg is fine if it has beneficial effects on yield and production characteristics.

    Keywords: Alpha-lipoic, Chromium, Gene expression, Immune response
  • محمود نظری*، سپیده رستمی
    اسانس گیاه مورد اثرات ضدمیکروبی، آنتی اکسیدانی و ضدالتهابی دارد.  تانن ها و فلاوونوئید موجود در گیاه مورد دارای خاصیت آنتی اکسیدانی است.  در نتیجه می توان انتظار داشت که اسانس گیاه مورد بتواند سیستم ایمنی جوجه گوشتی را تحت تاثیر قرار دهد.  بنابراین در این تحقیق اثر اسانس مورد بر بیان سایتوکین های اینترلوکین 1، 2، 4 و 10 بافت روده کوچک جوجه گوشتی مورد بررسی قرار گرفت.  بدین منظور از 200 قطعه جوجه گوشتی سویه تجاری راس 308 در قالب طرح کاملا تصافی با 2 تیمار، 5 تکرار و 12 قطعه جوجه در هر تکرار استفاده شد.  دو تیمار آزمایشی شامل:  1- جیره شاهد، 2- جیره پایه به همراه 250 میلی گرم بر کیلوگرم جیره اسانس مورد بود.  در انتهای آزمایش یک مرغ از هر تکرار کشتار شده و بافت آن ها سریعا جدا و به همراه ازت مایع به آزمایشگاه منتقل گردید.  بیان ژن های پروفایل سیتوکینی به روش واکنش زنجیره ای پلیمراز در زمان واقعی ارزیابی شد.  تجزیه واریانس نشان داد که افزودن 250 میلی گرم بر کیلوگرم اسانس مورد در جیره غذایی مرغ گوشتی بر بیان ژن IL-2 و IL-10 اثر معنی داری نداشته است.  در حالی که بیان ژن های IL-1 و IL-4 اثر معنی داری داشت.  این نتایج نشان دهنده این است که اسانس مورد با کاهش سایتوکین های پیش التهابی می تواند در پاسخ ایمنی سلولی در روده کوچک مرغ گوشتی نقش ایفا کند.  پس می توان با افزودن اسانس مورد در جیره جوجه گوشتی از خصوصیات ضد التهابی آن بهره برد.
    کلید واژگان: اسانس مورد، بیان ژن، پاسخ ایمنی، سایتوکین
    Mahmood Nazari *, Sepideh Rostami
    Myrtle essential oil (MEO) has antimicrobial, antioxidant, and anti-inflammatory effects. Especially, tannins and flavonoids in MEO have antioxidant properties. So, it can be expected that MEO can affect the immune system of broilers. Therefore, in this research, the effect of MEO on the gene expression of cytokines (IL-1, IL-2, IL-4, and IL-10) in the tissues of the small intestine of broiler chickens was investigated. For this purpose, 120 Ross 308 broiler chicks in a completely randomized design with 2 treatments, 5 replicates and 12 chicks were used in each replicate. The treatments included: 1- control diet, 2- basal diet plus 250 mg / kg MEO. After 42 days, at the end of testing one chickens each replicate were slaughtered and their tissues were excised quickly and transported with liquid nitrogen to the laboratory. Quantitative real-time PCR was used to measure the expression of the cytokines. Analysis of variance showed that the addition of 250 mg/kg of the myrtle essential oil (MEO) in the diet of broiler chickens had no significant effect on IL-2 and IL-10 gene expression. While the expression of IL-1 and IL-4 genes had a significant effect. These results indicate that the myrtle essential oil can play a role in the cellular immune response in the small intestine of broiler chicken by reducing pro-inflammatory cytokines. So, the anti-inflammatory aspect of MEO could be used by adding it to the diet of broilers.
    Keywords: Myrtle essential oil, Gene expression, Immune response, cytokine
  • محمود نظری*، هدایت الله روشنفکر، فاطمه ثعلبی
    هدف

    زهر زنبور عسل حاوی آنزیم هایی مختلفی نظیر هیالورونیداز و فسفولیپاز A2 است که بعضی از آنها کاربرد دارویی و پزشکی دارند. در تحقیقات متعددی، فعالیت فسفولیپاز A2 و هیالورونیداز در گونه های مختلف زنبور عسل گزارش شده است اما گزارشی در مورد این آنزیم ها و چگونگی فعالیت آنها در زهز زنبور عسل ایرانی وجود ندارد. لذا هدف از این تحقیق جداسازی، شناسایی آنزیم های فسفولیپاز A2 و هیالورونیداز و اندازه گیری میزان فعالیت آنها در زهر خام و اجزای زهر زنبور عسل ایرانی (Apis mellifera meda) بود.  

    مواد و روش ها

    ابتدا 100 میلی گرم زهر خام زنبور عسل با کمک کروماتوگرافی سفادکس G-50 در بافر استات آمونیوم 05/0 میلی مولار خالص سازی شد. جهت بررسی پروفایل پروتیینی زهر و  جزءبندی از روش الکتروفورز عمودی استفاده گردید. سپس مقدار پروتیین، فعالیت آنزیم فسفولیپاز A2 و هیالورونیداز در زهر خام و فراکسیو ن های جدا شده اندازه گیری شد. مقدار پروتیین در زهر خام عسل ایرانی و اجزای آن با استفاده از پروتیین سنجی بروش برادفورد تعیین گردید. میزان فعالیت آنزیم فسفولیپاز A2  با استفاده از سوسپانسیون زرده تخم مرغ به عنوان سوبسترا تعیین شد و میزان فعالیت هیالورونیداز روی هیالورونیک اسید به روش توربیدومتری آزمایش شد. 

    نتایج

    نتایج اولیه نشان داد که 56 درصد زهر خام پروتیین بوده است. زهر خام به 3 پیک (جزء) مجزا شد. فعالیت فسفولیپاز A2 در زهر خام و پیک اول و دوم مشاهد شد. فراکسیون دوم بیشترین فعالیت فسفولیپازی را نشان داد. فعالیت هیالورونیدازی در زهرخام و تنها در پیک اول مشاهده شد. فعالیت بهینه آنزیم فسفولیپاز A2 در pH برابر 7 و دمای 37درجه سانتیگراد بدست آمد. در این مطالعه مشخص شد که فعالیت هیالورونیداز در زهر زنبور عسل ایران بیشترین فعالیت را در دمای 37 تا 39 درجه دارد و با افزایش درجه حرارت به تدریج فعالیت خود را از دست می دهد. همچنین نتایج این مطالعه نشان داد که pH ایده آل برای فعالیت آنزیم هیالورونیداز 5/5 می باشد.

    نتیجه گیری

    زهر زنبور عسل ایرانی دارای هر دو فعالیت فسفولیپازی و هیالورونیدازی می باشد که با استفاده از کروماتوگرافی ژل فیلتراسیون می توان آنها را جدا کرد. این بررسی می تواند به عنوان روشی برای جداسازی، تخلیص و اندازه گیری فعالیت آنزیم های هیالورونیداز و فسفولیپاز A2 زهر زنبور عسل ایرانی معرفی شود. آنزیم های هیالورونیداز و فسفولیپاز A2 خالص سازی شده می توانند جهت استفاده در صنعت و تحقیقات مورد استفاده قرار گیرند.

    کلید واژگان: زنبور عسل ایران، هیالورونیداز، فسفولیپاز
    Mahmood Nazari *, Hedaiat Allah Rooshanfekr, Fatemeh Salabi
    Objective

    Bee venom contains various enzymes such as hyaluronidase and phospholipase A2, which have medical and pharmaceutical applications. In several studies, the activity of phospholipase A2 and hyaluronidase has been reported in different bee species, but there is no report about these enzymes and their activities in Iranian honey bee venom. Therefore, the purpose of this research was to isolate, identify phospholipase A2 and hyaluronidase enzymes and measure their activity in crude venom and its fractions of Iranian honey bee (Apis mellifera meda).

    Materials and methods

    One hundred mg of the crude venom was purified using gel filtration chromatography on sephadex G-50, equilibrated with 0.05mM ammonium acetate buffer. SDS-PAGE was used to determine the protein profile of BV and its fractions. Protein concentration, phospholipase A2 and hyaluronidase enzyme activity of Apis mellifera crude venom and its fractions were measured. Protein concentration of Apis mellifera crude venom and its fractions was determined using Bradford method. Phospholipase A2 (PLA2) activity was determined using suspension of egg yolk as substrate. The activity of hyaluronidase was determined turbidimetrically.

    Results

    The preliminary results showed that the 56% of crude venom was protein. Crude venom produced three fractions. Phospholipase A2 activity was observed in the crude venom as well as in the first and second fractions. The second fraction showed the highest phospholipase activity. Hyaluronidase activity was observed in crude venom and only in the first fraction. The optimal activity of bee venome phospholipase A2 enzyme was obtained at pH 7 and 37 °C. In this study, it was found that the activity of hyaluronidase in Iranian honey bee venom has the highest activity at 37 to 39 °C and gradually loses its activity as the temperature increases. Also, the results of this study indicate that the optimum pH for hyaluronidase enzyme activity is 5.5.

    Conclusions

    Iranian honey bee venom has both phospholipase and hyaluronidase activities, which can be separated using gel filtration chromatography. This study can be introduced as a simple method to isolate, purify and measure the activity of hyaluronidase and phospholipase A2 enzymes of Iranian honey bee venom. Purified hyaluronidase and phospholipase A2 enzymes can be used in industry and research.

    Keywords: Apis mellifera meda, Phospholipase, Hyaluronidase
  • محمود نظری*، محمدرضا قربانی، محمدتقی بیگی نصیری، ندا فتحی مقدم، راضیه صباحی، سیده تقوا موسوی

    مصرف استروژن در زنان می تواند خطر ابتلا به سرطان سینه را افزایش دهد.  استروژن رشد سلول های سرطانی را از طریق گیرنده استروژن آلفا تحریک می کند.  یکی از استراتژی هایی که اخیرا مورد توجه قرار گرفته است، استفاده از فیتواستروژن ها است.  مطالعات قبلی نشان داده است که گیاه ویتکس حاوی سطوح بالایی از فیتواستروژن است.  در مورد این که آیا فیتواستروژن های موجود در گیاه ویتکس برای اتصال کدام گیرنده (استروژن آلفا یا بتا) را انتخابی می کنند اختلاف نظر وجود دارد.  با در نظر گرفتن این موضوع که در اوویداکت مرغ تخم گذار تنها گیرنده استروژن آلفا حضور دارد، در این آزمایش از مرغ های تخم گذار به عنوان مدل برای یافتن پاسخ استفاده شد.  در این مطالعه اثر پودر میوه ویتکس بر عملکرد، کیفیت تخم مرغ، پاسخ ایمنی و بیان ژن های GnRH، LH، اوومویید و اووآلبومین در مرغ های تخم گذار بررسی شد.  تعداد 90 قطعه مرغ تخم گذار لگهورن (Hy-Line, W-36) در سن (72 تا 80 هفتگی) در قالب طرح کاملا تصادفی با سه تیمار و پنج تکرار مورد استفاده قرار گرفت.  تیمارها سطوح مختلف پودر میوه ویتکس شامل سطوح صفر، 1 و 2 درصد پودر میوه ویتکس به ازای هر کیلوگرم جیره بودند.  نتایج تحقیق حاضر نشان داد که پارامترهای عملکرد، کیفیت تخم مرغ و پاسخ های ایمنی تحت تاثیر سطوح مختلف پودر میوه ویتکس قرار نگرفتند.  نتایج واکنش زنجیره ای پلیمراز در زمان واقعی نشان داد که سطوح مختلف پودر میوه ویتکس تاثیر معنی داری بر بیان ژن های LH، اوومویید و اووآلبومین ندارد.  با این حال، بیان ژن GnRH در تیمار 3 (جیره غذایی حاوی 2 درصد ویتکس نسبت به گروه شاهد و 1 درصد ویتکس به طور قابل توجهی افزایش یافت.  علاوه بر این، افزودن 1 درصد پودر میوه ویتکس به جیره تاثیر معنی داری بر بیان ژن GnRH نداشت.  در نتیجه، مصرف مکمل میوه ویتکس در مرغ های تخم گذار توصیه نمی شود.  علاوه بر این، داده های ما این نظریه را تقویت می کند که فیتواستروژن های موجود در میوه های ویتکس، گیرنده استروژن بتا را برای اتصال یافتن انتخاب می کند.

    کلید واژگان: ویتکس، بیان ژن، گیرنده استروژن، سرطان
    Mahmood Nazari *, MohammadReza Ghorbani, MohamadThagi Beigi Nassiri, Neda Fathimoghadam, Razieh Sabahi, Seiedeh Taghva Mosavi

    Estrogen consumption in women can increase the risk of breast cancer. Estrogen stimulates the growth of cancer cells through the estrogen receptor alpha (ERα). One of the strategies that has recently been considered is the use of phytoestrogens. Previous studies have shown that Chaste-berry contains high levels of phytoestrogens. Scientists disagree on whether the phytoestrogens in Chaste-berry are used to treat many diseases in women, which are ERα or ERβ selective. In the present study, laying hens were used as a model to find the answer because only alpha estrogen receptor is expressed in the oviduct. In this study, the effect of Chaste-berry fruit powder on performance, egg quality, immune response, and the expression of GnRH, LH, ovalbumin (OVAL), and ovomucoid (OVM) genes in laying hens were evaluated. A total of 90 leghorns (Hy-Line, W-36) laying hens (at 72 to 80 weeks old) were used in a completely randomized design with three treatments and five replicates (n=6). The treatments were various levels of Chaste-berry fruit powder including zero, 1, and 2% levels of Chaste-berry fruit powder per kg of diet. Our results showed that performance parameters, egg quality factors, and immune responses were not significantly affected by various levels of Chaste-berry fruit powder. Moreover, the results indicated that the various levels of Chaste-berry did not have a significant effect on LH, OVAL, and OVM gene expression. However, GnRH gene expression was significantly increased in treatment 3 (a diet containing 2% Chaste-berry) compared to the control and 1% Chaste-berry groups. Moreover, the addition of 1% Chaste-berry fruit powder to the diet had no significant effect on GnRH gene expression. Therefore, Chaste-berry supplementation is not recommended in laying hens. Furthermore, our data reinforce this theory that phytoestrogens in Chaste-berry fruits are ERβ-selective.

    Keywords: Chaste-berry, Estrogen Receptor, Phytoestrogen, cancer
  • مژگان نوروزی، محمود نظری، مهدی چهاردولی، محمدرضا حاجی زاده، محمدرضا میرزایی، زهرا اسداللهی، مهدی محمودی
    زمینه و هدف

    با توجه به این که یافتن داروهای جدید با عوارض جانبی کمتر برای کاهش قند در افراد دیابتی ضروری به نظر می رسد، هدف مطالعه تعیین تاثیر عصاره میوه کور بر آنزیم های کلیدی مسیرهای متابولیسم گلوکز در سلول های کبدی موش های نر دیابتی بود.

    مواد و روش ها

    در این مطالعه تجربی، تعداد 60 سر موش صحرایی به طور تصادفی به 6 گروه تقسیم شدند. گروه های 1 تا 3 به ترتیب حیوانات نرمال که آب مقطر، غلظت 200 و 800 میلی گرم بر کیلوگرم عصاره، و گروه های 4 تا 6 موش های صحرایی دیابتی که آب مقطر، غلظت200 و 800 میلی گرم بر کیلوگرم عصاره را به ترتیب دریافت کردند. القاء دیابت با تزریق درون صفاقی ماده استرپتوزوتوسین با دوز 50 میلی گرم بر کیلوگرم صورت گرفت. اندازه گیری هورمون انسولین و گلوکز سرم با کیت مربوطه، فعالیت آنزیم های گلوکوکیناز و هگزوکیناز به روش دستی و بیان ژن فسفوفروکتوکیناز و گلوکز 6 فسفاتاز به روش Real Time-PCR صورت گرفت. داده ها با استفاده از آزمون ناپارامتریک Kruskal-Wallis و آزمون تعقیبی Mann-Whitney تجزیه و تحلیل شد.

    یافته ها

    تجویز عصاره، سطح سرمی گلوکز را کاهش و سطح سرمی انسولین و گلوکیناز و میزان بیان ژن های فسفوفروکتوکیناز-1 را در تمام گروه های دریافت کننده عصاره نسبت به گروه های کنترل افزایش داد و میانگین فعالیت آنزیم هگزوکیناز و بیان ژن گلوکز 6 فسفاتاز در بین بیشتر گروه ها اختلاف معنی داری نشان داد (001/0>P).

    نتیجه گیری

    تیمار حیوانات دیابتی با عصاره گیاه کور باعث کاهش معنی دار قند خون و افزایش میزان انسولین سرمی گردید و هم چنین منجر به بهبود وضعیت فعالیت آنزیم های دخیل در گلیکولیز شد. بنابراین، به نظر می رسد که مصرف این میوه اثرات مفیدی بر روی قند خون و ترشح انسولین و هم چنین متابولیسم قند داشته باشد.

    کلید واژگان: کور، موش صحرایی دیابتی، متابولیسم، گلوکوکیناز، هگزوکیناز
    Mojgan Noroozi, Mahmoud Nazari, Mehdi Chahardoli, MohammadReza Hajizadeh, MohammadReza Mirzaei, Zahra Assadollahi, Mehdi Mahmoudi
    Background and Objectives

    Since finding new drugs with fewer side effects to reduce blood sugar in diabetics seems necessary, the present study aimed to evaluate the effect of the different doses of Capparis spinosa fruit extract on key enzymes of glucose metabolism pathways in the liver cells of diabetic male rats.

    Materials and Methods

    In this experimental study, 60 male Wistar rats were randomly divided into 6 groups. Groups 1-3 were normal (nondiabetic) rats that received distilled water, and 200 and 800 mg/kg extract, respectively, and groups 4-6 were diabetic rats that received distilled water, and 200 and 800 mg/kg extract, respectively. Diabetes induced by intraperitoneal injection of 50 mg/kg streptozotocin. Serum levels of insulin and glucose were measured by special kits, the activity of glucokinase and hexokinase was measured manually, and gene expression of phosphofructokinase-1 and glucose-6-phosphatase was determined by Real Time-PCR. Data was analyzed using non-parametric Kruskal-Wallis H test and post hoc Mann-Whitney U test.

    Results

    Administration of Capparis spinosa fruit extract decreased the serum level of glucose but increased the serum level of insulin and glucokinase and the level of expression of phosphofructokinase-1 genes in all groups receiving the extract compared to the control groups, and the average activity of glucose-6-phosphatase and hexokinase in different groups was significantly different (p<0.001).

    Conclusion

    The treatment of diabetic animals with Capparis spinosa fruit extract caused a significant decrease in blood sugar and an increase in serum insulin levels, and also led to an improvement in the activity of enzymes involved in glycolysis. Therefore, it seems that the consumption of this fruit has beneficial effects on blood sugar and insulin secretion as well as sugar metabolism.

    Keywords: Capparis Spinosa, Diabetic Rats, Metabolism, Glucokinase, Hexokinase
  • سیده تقوا موسوی، محمدتقی بیگی نصیری، هدایت الله روشنفکر، محمود نظری*، محمدرضا قربانی
    مقدمه و هدف

    فیتواستروژن ها، استروژن های گیاهی با عملکرد و ساختار استروژن هستند. استروژن در فرآیند سنتز پروتیین های سفیده تخم مرغ در مجرای اویداکت مرغ نقش مهمی ایفا می کند. گیاه پنج انگشت یک گیاه بومی کشورهای آسیای میانه، مرکزی، جنوب اروپا و کشورهای مدیترانه است. این گیاه در طب سنتی کاربردهای متعددی دارد. مطالعات قبلی نشان داده است که گیاه پنج انگشت حاوی سطوح بالایی از فیتواستروژن است. فعال ترین فیتواستروژن ها در پنج انگشت شامل آپیژنین، وایتکسین و پندولتین است. تاکنون مطالعه ای در مورد اثر فیتواستروژن های گیاه پنج انگشت بر بیان نشانگرهای ژنی اوویداکت (اووآلبومین و اوومویید) مرغ تخمگذار منتشر نشده است. از این رو، این مطالعه به منظور بررسی تاثیر میوه های گیاه پنج انگشت بر بیان ژن های اووآلبومین و اوومویید اویداکت مرغ های تخم گذار انجام شد.

    مواد و روش ها

    تعداد 90 قطعه مرغ تخم گذار لگهورن (Hy-Line, W-36) در چرخه دوم تولید (در سن 72 تا 80 هفتگی) در قالب طرح کاملا تصادفی با سه تیمار، پنج تکرار و 6 قطعه مرغ در هر تکرار مورد استفاده قرار گرفت. تیمارها شامل سطوح مختلف پودر میوه پنج انگشت شامل سطوح صفر، 1 و 2 درصد پودر میوه پنج انگشت به ازای هر کیلوگرم جیره بودند. پس از استخراج RNAی کل، کیفیت RNA با استفاده از نانودراپ و الکتروفورز ژل آگارز مورد بررسی قرار گرفت و با استفاده از کیت سیناکلون cDNA سنتز شد. میزان بیان ژن با استفاده از تکنیک واکنش زنجیره ای پلیمراز در زمان واقعی اندازه گیری شد. در این روش از ژن بتااکتین به عنوان ژن مرجع جهت نرمال نمودن داده ها استفاده شد. برای تایید اختصاصیت هر پرایمر نمودار ذوب آن مورد بررسی قرار گرفت.

    یافته ها

    الکتروفورز ژل آگارز محصولات واکنش زنجیره ای پلیمراز به ترتیب قطعات 60، 133 و 150 جفت باز را برای اووآلبومین، اوومویید و بتااکتین نشان داد. همه نمودارهای ذوب دارای یک پیک بودند که نشان دهنده حداقل دایمر پرایمر و اختصاصیت پرایمرها برای هر ژن بود. نتایج واکنش زنجیره ای پلیمراز در زمان واقعی نشان داد که مکمل سازی میوه پنج انگشت در سطوح 1 و 2 به جیره مرغ های تخمگذار تاثیری بر بیان ژن های اووآلبومین و اوومویید مرغ تخمگذار ندارد.

    نتیجه گیری

    انتظار نمی رود که افزودن پودر میوه پنج انگشت به جیره مرغ های تخمگذار سبب افزایش تولید در مرغ تخمگذار شود. بنابراین افزودن گیاه پنج انگشت به جیره مرغ های تخمگذار پیشنهاد نمی شود.

    کلید واژگان: اووآلبومین، بیان ژن، مرغ تخمگذار، وایتکس
    Seyed Taghva Mosavi, MohammadTaghi Beigi Nassiri, Hedayetollah Rooshanfekr Roshanfekr, Mahmood Nazari*, Mohammad Reza Ghorbani Ghorbani
    Introduction and Objective

    Phytoestrogens are herbal estrogens with estrogen-like functions and structures. The estrogen hormone has an important role in the process of the synthesis of egg white proteins in the avian oviduct. Vitex agnus-castus (VAC) is a native plant of the middle Asian, southern European, and Mediterranean countries. This plant has numerous uses in traditional medicine and is traditionally used to treat many diseases in women. Previous studies have shown that VAC contains high levels of phytoestrogens. VAC consists of compounds such as vitexin, apigenin, and pendoltin, which are the most active phytoestrogen in VAC fruits. No study has been published so far on the effect of VAC on oviduct markers gene expression (ovalbumin (OVAL) and ovomucoid (OVM)). Hence, this study was performed to evaluate the effect of VAC fruits on gene expression for two oviduct markers OVAL and OVM of laying hens.

    Material and Methods

    A total of 90 leghorns (Hy-Line, W-36) laying hens on the second cycle of production (at 72 to 80 weeks old) were used in a completely randomized design with three treatments, five replicates and six hens per replivate. The treatments were various levels of VAC fruit powder including zero, 1, and 2% levels of VAC fruit powder per kg of diet. After extraction of total RNA, RNA quality was evaluated using Nanodrop and agarose gel electrophoresis and cDNA was synthesized using a Sinaclone kit. Eventually, gene expression was measured by the real-time qPCR method. In this method, 𝜷-actin gene was used as a reference gene to normalize the gene expression data. To confirm the specificity of each primer, its melting curves were examined.

    Results

    Electrophoresis of the PCR products showed the 60, 133, and 150-bp fragments for OVAL, OVM, and Beta-actin, respectively. Melting peaks analysis on the PCR products for all primers confirmed minimal primer-dimers and primer specificity. The results of the real-time qPCR method indicated that supplementation of VAC fruits powder at levels 1 and 2 to the diet of laying hens has no effect on the expression of OVAL and OVM genes of laying hens in the second production cycle.

    Conclusion

    Therefore, Adding VAC fruit powder to the diet of laying hens is not expected to increase egg production in laying hens. Therefore, VAC supplementation is not recommended to the diet of laying hens.

    Keywords: Gene expression, Hens, Ovalbumin, Vitex
  • سعید چعب، محمدتقی بیگی نصیری، محمود نظری*، جمال فیاضی

    ژن Mx نقش مهمی در پاسخ های ضد ویروسی مرغ دارد. ژن Mx یک کاندید بالقوه به عنوان یک نشانگر ژنتیکی مقاوم به ویروس آنفولانزا در مرغ می باشد. پژوهش حاضر به منظور بررسی چندشکلی ژن مقاومت به میکسوویروس (Mx) با استفاده از روش PCR-RFLP در مرغ بومی خوزستان انجام گرفت. به طور تصادفی از 100 قطعه مرغ بومی خوزستان از شهرهای (ملاثانی، اندیمشک، شوش) خون گیری شد و استخراج DNA از نمونه ‏ها انجام شد. واکنش زنجیره‏ای پلیمراز (PCR) برای تکثیر قطعه 299 جفت بازی ژن مقاومت به میگزو ویروس (Mx) به کمک آغازگرهای اختصاصی صورت گرفت. قطعه تکثیر شده به‏ وسیله آنزیم برشی HPY8l هضم گردید. فراوانی‏ آلل‏هایA  و G در مرغان بومی شوش به ترتیب  54/0 و 46/0 ، در ملاثانی 85/0 و 15/0و در اندیمشک 57/0 و 47/0 و فراوانی ژنوتیپ‏های AA، GG و AG به ترتیب در شوش 40/0، 33/0 و 27/0، در ملاثانی 8/0، 1/0 و 1/0 و در اندیمشک 45/0، 40/0 و 15/0 بود. نتایج نشان داد که فراوانی آلل A بیشتر از G است بعلاوه، هتروزیگوسیتی مشاهده شده و تعداد آلل موثر نشان داد که میزان تنوع این جایگاه ها در جمعیت پایین است. با استفاده از آزمون کای مربع (X2) مشخص شد که فراوانی آلل‏ها در این جایگاه ژنی در حالت تعادل هاردی - وینبرگ نمی‏باشد. نتایج این تحقیق پیشنهاد می داد که ژن MX دارای چندشکلی است و پتانسیل بالایی برای استفاده به عنوان نشانگر ژنتیکی برای مقاومت در برابر آنفولانزای مرغی و بیماری نیوکاسل دارد.

    کلید واژگان: ژن مقاومت به میکسوویروس (MX)، آنفولانزا، مرغ بومی و چندشکلی
    Saeed Chaab, MohamadTaghi Beigi Nassiri, Mahmood Nazari *, Jamal Fayazi

    The myxovirus (Mx) gene play a crucial role in the antiviral responses of chicken. The Mx gene is a potential candidate as a genetic resistance marker to the avian influenza virus in chickens. This study was conducted to determine the polymorphism of myxovirus gene polymorphism using PCR-RFLP method in Khuzestan native chicken. In this research, blood samples were collected randomly from 100 Khuzestan native chicken (Malasani, Andimeshk and Shush) and DNA were extracted. Polymerase chain reaction (PCR) was used to amplify 299bp fragments of myxovirus (Mx) gene by specific primers. Then, the amplified fragment was digested with HPY8l enzyme. Allele frequency for A and G, in Shoosh 0.54 and 0.46, Mollasani 0.85 and 0.15 and Andimeshk 0.57 and 0.47 and genotype frequencies of AA, GG and AG, in Shoosh 0.40, 0.33 and 0.27, Mollasani 0.8, 0.1 and 0.1 and Andimeshk 0.45, 0.40 and 0.15 were achieved, respectively. The results showed that the frequency of allele A was higher than G. Furthermore, the observed heterozygosity and the effective number of alleles demonstrated low diversity in the population. Chi-square (X2) analysis showed that the locus allele frequencies are not in Hardy-Weinberg equilibrium. The results of this study suggested that the MX gene had polymorphism and had a high potential for use as a genetic marker for resistance to avian influenza and Newcastle disease.

    Keywords: Mx gene, Native chicken, Avian Influenza, Polymorphism
  • محمدرضا توپا، هدایت الله روشنفکر، محمود نظری*

    کاهش چربی محوطه شکمی از اهداف مهم اصلاح نژاد طیور گوشتی است. مسیر گیرنده های فعال کننده تکثیر پراکسیزوم (PPARs) نقش مهمی در تجمع چربی ایفا می کند. این مسیر شامل گروهی از پروتیین های گیرنده هسته ای هستند که نقش اساسی در تکثیر، تمایز سلولی و متابولیسم دارند. بنابراین، شناسایی هر چه بهتر ژن های دخیل بر این مسیر اهمیت دارد. این تحقیق به منظور پیش بینی میکرو RNA های موثر بر مسیر گیرنده های فعال کننده تکثیر پراکسیزوم با هدف کاهش تجمع چربی در مرغ گوشتی انجام شد. پس از دریافت فایل ژنوم رفرنس مرغ (GRCg6a) از پایگاه داده Ensemble و وارد نمودن آن در پایگاه اطلاعاتی KEGG، تعداد 68 ژن دخیل در مسیر سیگنالینگ PPAR شناسایی شد. سپس شبکه ژنی با استفاده از پایگاه داده استرینگ ترسیم شد. علاوه بر این، تجزیه و تحلیل شبکه برهمکنش پروتیینی با استفاده از نرم افزار سایتواسکیپ انجام گردید. بر اساس شاخص های مرکزیت (شامل مرکزیت درجه، بینابینی و نزدیکی) ارایه شده توسط نرم فزار سایتواسکیپ ژن های ACOX1، PPARA ،LPL،FABP3 ،CPT1A ،EHHADH ، SCD و PPARGC1 به عنوان تاثیرگذار ترین ژن های مسیر سیگنالینگ PPAR انتخاب گردیدند و با استفاده از پایگاه های داده miRBase و Targetscan، میکرو RNA های متناظر با این ژنها شناسایی شدند. در نهایت، پیش بینی ژن هدف و رسم شبکه میانکنش پروتیین- میکروRNA توسط پایگاه داده Mirnet انجام شد. نتایج نشان داد میکرو RNA ی gga-mir-1759-3p بر سه ژن CPT1A، LPL و PPARGC1A تاثیرگذار است. شاید با بکارگیری این میکرو RNA بتوان میزان تجمع چربی را در طیور گوشتی کاهش داد.

    کلید واژگان: مسیر PPAR، چربی، مرغ گوشتی، میکرو RNA
    Mohamad Reza Toopa, Hedaiatollah Roshanfekr, Mahmood Nazari *

    Chicken is one of the most important sources of meat in human societies. One of the important goals of broiler breeding is to reduce the accumulation of fat in broilers. The pathways of peroxisome proliferative activating receptors (PPARs signal pathway) play an important role in fat accumulation. This pathway includes a group of nuclear receptor proteins that play a key role in proliferation, cell differentiation, and metabolism (carbohydrates, lipids, proteins). Therefore, it is important to identify the genes involved in this pathway. This study was performed to predict the microRNAs affecting the peroxisome proliferator receptors (PPARs) with the aim of reducing fat accumulation in broilers. Analysis of the chicken genome reference file in the KEGG database led to the identification of 68 genes involved in the signaling pathway (PPAR). Then, the gene network is drawn by using a STRING network. In addition, protein interaction network analysis was performed using Cytoscape software. Eight genes ACOX1, PPARA, LPL, FABP3, CPT1A, EHHADH, SCD, and PPARGC1 were selected as the most influential genes of the PPAR signaling pathway based on centrality indices (including degree centrality, betweenness centrality, closeness centrality) provided by Cytoscape software. Also, the microRNAs corresponding to these genes was identified using databases: MIRdb and Targetscan. Finally, the MirNet network was utilized for the prediction of target genes and drawing a protein-microRNA interaction network. The results showed that gga-mir-1759-3p affects three genes CPT1A, LPL, and PPARGC1A. Perhaps using this micro-RNA can reduce the accumulation of fat in broiler.

    Keywords: PPAR signaling pathway, Broiler, Fat accumulation, MicroRNA
  • محمود نظری*، غزال محمدی اهوازی

    خلوص ژنتیکی نژادهای گوسفند با توجه به تلاقی های کنترل نشده رو به کاهش است به همین علت حفظ تنوع زیستی در نژادهای بومی به عنوان یک سرمایه ملی ضرورت دارد. بنابراین هدف از انجام این پژوهش بررسی تنوع ژنتیکی و فیلوژنتیکی ناحیه HVR I D-loop ژنوم میتوکندری، بین سه نژاد گوسفند تالشی، شال و ماکویی بود. جهت انجام آنالیزها از توالی های ناحیه D-loop میتوکندری سه نژاد تالشی، شال و ماکویی ذخیره شده در بانک اطلاعاتی NCBI استفاده شد. تنوع نوکلیوتیدی برای نژاد تالشی، شال و ماکویی به ترتیب 04160/0، 04552/0 و 04422/0 و تنوع هاپلوتایپی در هر سه نژاد 00/1 برآورد شد. همچنین نتایج تجزیه واریانس مولکولی (AMOVA) حاکی از آن بود که تنوع درون جمعیت ها 100 درصد و تنوع بین جمعیت ها صفر درصد بود. این نتایج بیانگر وجود تنوع بسیار بالا در این نژادها می باشد. محاسبه D تاجیمای منفی برای نژاد تالشی بیان کننده این موضوع است که جمعیت نژاد تالشی بعد از گذراندن یک تنگنای ژنتیکی در حال گسترش است و انتخاب جهت دار در حال انجام است. در حالی که محاسبه D تاجیمای مثبت برای دو نژاد شال و ماکویی نشان می دهد که این دو جمعیت در حال گزینش متعادل کننده هستند. با رسم درخت فیلوژنتیک به روش NJ مشخص گردید هر سه نژاد گوسفند در گروه هاپلوتایپی D قرار دارند. از قرارگیری این نژادها در گروه نژادهای قفقاز و ترکیه می توان نتیجه گرفت که این سه نژاد از نژادهای قدیمی و باستانی هستند و باید جهت حفظ این سرمایه های ملی تلاش بیشتری کرد.

    کلید واژگان: تنوع ژنتیکی، HVR I، درخت فیلوژنتیک، ژنوم میتوکندری، گوسفند
    M .Nazari *, Gh .Mohamadi Ahvazi

    The genetic purity of sheep breeds is declining due to uncontrolled crossbreeding, so it is essential to preserve biodiversity in native breeds as a national asset. Therefore, the purpose of this study was to investigate the genetic and phylogenetic diversity of the mitochondrial HVR I region between the three Taleshi, Makui and Shal breeds. For this purpose, HVR I sequences of these three breeds were downloaded from NCBI database. Nucleotide diversity for Taleshi, Shawl and Makui breeds calculated 0.0416, 0.04552 and 0.04422, respectively, and haplotype diversity in all three breeds was estimated to be 1.00. In addition, the results of molecular analysis of variance (AMOVA) showed that the diversity within populations was about %100 and in fact the total diversity was included and the diversity between populations was %0. These results indicated high genetic variation in three sheep breeds. Negative Tajima''s D for Taleshi breed indicated that the this population is expanding after going through a recent bottleneck and selection sweep is in progress, while positive Tajima''s D for shawl and Makui breeds demonstrated that these two populations are balancing selection. The NJ phylogenetic test results indicated that all three breeds of sheep were classified into haplotype D. From the classification of these breeds with the Caucasian and Turkish breeds in one branch, it can be concluded that these three breeds are the ancient breeds of sheep and more efforts should be made to preserve these national assets.

    Keywords: Genetic diversity, HVR I, Phylogenetic tree, Mitochondrial genome, Sheep
  • فاطمه بانکی زاده*، هدایت الله روشنفکر، محمدحسین بنابازی، محمود نظری، رضا صفری

    اسپلایسووزم یک کمپلکس بزرگ ریبونوکلیوپروتیینی است، که فرآیند پیرایش mRNAی پیش ساز را در سلول های یوکاریوتی هدایت می کند. در مطالعه حاضر پروفایل ترانسکریپتوم هیپوفیز بوقلمون مادر تجاری از نژاد بیوتی طی مراحل تخم گذاری و کرچی مورد بررسی قرار گرفت. تعداد 334 ژن با بیان متفاوت بین دو گروه تشخیص داده شد، که 229 ژن دارای بیان زیاد و 105 ژن دارای بیان کم در گروه تخم گذار در مقایسه با گروه کرچ مشاهده شد. در این مطالعه نتایج تجزیه و تحلیل هستی شناسی و KEGG نشان داد که ژن های مسیر اسپلایسوزوم نقش موثری در مرحله انتقال از تخم گذاری به کرچی بوقلمون ها داشتند (05/0>P). علاوه بر این در مسیر انتقال یون کلسیم در بخش عملکرد مولکولی، فرآیند پیرایش باعث فعال شدن و ایجاد ایزوفرم های مختلف ژن مربوط به کلسیم -کالمادولین وابسته به پروتیین کیناز دو آلفا شد، که نقش مهمی در سیستم نوروترانسمیتری و هورمونی دارد. در این مطالعه نشان داده شد که، ژن های SNRPD1، SNRPF و SNRPA1 مربوط به کمپلکس اسپلایسوزوم برای ساخت فولیکول ها و باروری ضروری هستند. ژن HSPA8 نیز که در بوقلمون های تخم گذار نسبت به کرچ بیان کمتری داشت، در اتوفاژی و تخریب فولیکول ها در بوقلمون های کرچ نقش داشت.

    کلید واژگان: اسپلایسوزوم، هیپوفیز، کرچی، تخمگذاری، بیان ژن
    F .Bankizadeh *, H. Roshanfekr, M.H .Banabazi, M. Nazari, R. Safari

    The spliceosome is a large ribonucleoprotein complex that guides pre-mRNA splicing in eukaryotic cells. In this research, pituitary transcriptome profile of commercial breeder turkey of BUT breed was studied during the laying and broodiness phases. A total of 334 differentially expressed genes during egg-laying phases and brooding phases were identified. There were 229 upregulated and 104 downregulated at egg-laying phases compared with brooding phases. In the present study results of both GO and KEGG analysis suggested that the genes in the spliceosome complex are critical in the transition from the egg-laying to brooding phase turkeys. In addition, in the calcium ion transport in the biological process, splicing activates and creates various isoforms of the calcium/calmodulin alpha, which plays an important role in the neurotransmitter and hormonal systems of turkeys. In this study it was revealed that SNRPD1, SNRPF and SNRPA1/U2A in spliceosome complex were essential for folliculogenesis and fertility. HSPA8 wassignificantly down-regulated at laying turkeys compared with broodiness turkeys was involved in autophagy and follicular regression in broody turkey.

    Keywords: Spliceosome, Pituitary, Broodiness, Egg-Laying, Gene expression
  • اقبال یاوری، جمال فیاضی، محمود نظری*، خلیل میرزاده

    ژن DGAT1 با کد کردن آنزیم دی آسیل گلیسرول آسیل ترانسفراز (DGAT1) نقش اصلی را در ساخت تری گلیسیرید و چربی شیر دارد. تحقیقات اخیر نشان داده که چندشکلی در ژن DGAT1 بر صفت تولید شیر موثر است. لذا هدف از این تحقیق بررسی چندشکلی اگزون 14 ژن DGAT1 در شترهای تک کوهانه خوزستان با استفاده از روش چندشکلی شکل فضایی رشته های منفرد (SSCP) بود. برای انجام این آزمایش از 80 نفر شتر تک کوهانه خونگیری به عمل آمد. پس از استخراج DNA، یک قطعه 310 جفت بازی از اگزون 14 ژن DGAT1 با استفاده از واکنش زنجیره پلی مراز (PCR) تکثیر گردید. در این مطالعه 6 الگوی باندی متفاوت به عنوان شش ژنوتیپ متفاوت شامل AA، AB، BB، CC، DD و EE به ترتیب با فراوانی های 45 ، 75/33 ، 5، 75/3 ، 5/2 و 10 درصد و پنج نوع آلل A، B، C، D و E به ترتیب با فراوانی های 619/0، 219/0، 038/0، 025/0، 1/0 شناسایی گردید. بعلاوه، آزمون کای مربع نشان داد که جمعیت در این جایگاه در تعادل هاردی-‏وینبرگ قرار ندارد. تعداد آلل موثر، شاخص شانون، هتروزیگوسیتی مورد‏انتظار و مشاهده شده برای این جایگاه به ترتیب 259/2، 07/1، 557/0 و 338/0 محاسبه گردید. این نتایج نشان دهنده‏ی وجود چندشکلی است اما نشان می داد که میزان هتروزیگوسیتی در جمعیت مورد مطالعه کم است. پیشنهاد می گردد با تدوین برنامه های اصلاح نژادی مناسب تنوع موجود در جمعیت شتر تک کوهانه خوزستان افزایش داده شود.

    کلید واژگان: چند شکلی، DGAT1، SSCP، شتر تک کوهانه
    E. Yavari, J. Fayazi, M Nazari *, Kh. Mirzadeh

    The Diacylglycerol O-Acyltransferase 1 (DGAT1) gene plays a key role in the production of triglycerides and milk fat by encoding the enzyme DGAT1. Recent research has shown that polymorphisms in the DGAT1 gene affect milk production. Therefore, the aim of this study was to investigate polymorphism in exon 14 region of DGAT1 gene in Khuzestan dromedary camels (Camelus dromedarius) using PCR-SSCP method. To perform this experiment, blood samples were collected from 80 dromedary camels in Khuzestan province. After DNA extraction, a 310-bp fragment of exon 14 region of DGAT1 gene was amplified using polymerase chain reaction (PCR). Six different SSCP patterns, including six different genotypes of AA (45%), AB (33.75%), BB (5%), CC (3.75%) , DD (2.5%) and EE (10%) and five alleles including A (0.619), B (0.219), C (0.038), D (0.025) and E (0.1) were identified. Moreover, the chi-square (χ2) test showed that the population was not in Hardy-Weinberg equilibrium. The number of effective alleles, Shannon index, expected and observed heterozygosity for this site was calculated 2.259, 1.07, 0.557 and 0.338, respectively. The results indicated polymorphism and low heterozygosity in the population under study. It is suggested to increase the diversity in the dromedary camel population of Khuzestan by developing appropriate breeding programs.

    Keywords: Polymorphism, DGAT1, SSCP, Dromedary Camel
  • حسن چنانی، محمود نظری*، محمدتقی بیگی نصیری، هدایت الله روشنفکر، علی آقایی

    ژن DMB2 یکی از ژن های خوشه MHC است که در پاسخ ایمنی همورال نقش ایفا می کند. این تحقیق جهت شناسایی چندشکلی ناحیه اگزون 2 ژن MHC-DMB2 و ارتباط آن با پاسخ ایمنی همورال در بلدرچین ژاپنی انجام گرفت. بدین منظور در روز 28 دوره پرورش، مقدار 2/0 میلی لیتر محلول پنج درصد گلبول قرمز خون گوسفندی (SRBC) به عضله سینه 130 بلدرچین ژاپنی (65 نر و 65 ماده) تزریق شد و هفت روز بعد در روز 35 دوره پرورش، خون گیری جهت تعیین تیتر آنتی بادی علیه SRBC  انجام شد. DNA ژنومی از نمونه‏های خون استخراج شد و قطعه‏ای به اندازه 333 جفت باز از این جایگاه با استفاده از واکنش زنجیره‏ای پلی‏مراز (PCR) تکثیر شده و محصولات PCR به وسیله آنزیم برشی Hinf I هضم شدند. نتایج حاصل حاکی از وجود دو نوع آلل C (333 جفت بازی) و آلل G (226 و 107 جفت بازی) در این جایگاه بود که فراوانی آن‏ها در کل جمعیت به ترتیب 6/74 و 4/25 درصد محاسبه شد.‏‏ نتایج نشان دهنده‏ وجود چندشکلی و میزان هموزیگوسیتی بالا در جمعیت مورد مطالعه است. به علاوه، نتایج نشان داد که ژنوتیپ اثر معنی داری بر تیتر آنتی بادی دارد (01/0 <p). ژنوتیپ CC بیشترین (13/2 میلی گرم بر دسی لیتر) و ژنوتیپ GG کمترین تیتر آنتی بادی کل (33/0 میلی گرم بر دسی لیتر) را نشان داد. پیشنهاد می شود آثار منفی این چندشکلی تک نوکلیوتیدی در برنامه های اصلاح نژادی در نظر گرفته شود.

    کلید واژگان: ایمنی همورال، بلدرچین ژاپنی، چندشکلی، ژن DMB2، PCR-RFLP
    H. Chenani, M. Nazari *, M. T. Beigi Nassiri, H. Roshanfekr, A. Aghaei

    The DMB2 gene is one of the MHC cluster genes that plays a role in the humoral immune response. This study was performed to identify the polymorphism of exon 2 of the MHC-DMB2 gene and its association with the humoral immune response in Japanese quail. For this purpose, on day 28, 0.2 mL of 5% saline suspension of sheep red blood cell (SRBC) was injected into 130 quail's breast muscle (65 males and 65 females). Seven days later, cervical vein blood sampling was performed on the 35th day. Afterward, the anti-SRBC titer antibody was determined using a micro hemagglutination technique. Also, genomic DNA was extracted from blood samples and a 333bp fragment of exon 2 was amplified using polymerase chain reaction and PCR products were digested by Hinf 1 restriction enzyme. The results showed that there were two types of C (333bp) and G (226, 107bp) alleles in this region with a frequency of 74.6% and 26.4% in the whole population, respectively. The results indicate high polymorphism and high homozygosity in the studied population. In addition, the results showed that genotype had a significant effect on antibody titers (P<0.01). The CC genotype showed the highest total antibody titer (2.13 mg/dL) and the GG genotype showed the lowest total antibody titer (0.33 mg/dL). It is suggested that the negative effects of this single nucleotide polymorphism be considered in breeding programs.

    Keywords: Humoral immunity, Japanese quail, Polymorphism, DMB2 gene, PCR-RFLP
  • مولود ربیعه، هدایت الله روشنفکر، محمود نظری*، محمدرضا قربانی

    این تحقیق به منظور ارزیابی اثر عصاره ی گیاهان خرفه، پسته ی وحشی و ویتامین E بر بیان ژن های آنزیم های آنتی اکسیدانی (سوپراکسید دیسموتاز و کاتالاز) در جوجه های گوشتی تحت استرس گرمایی اجرا گردید.  بدین منظور از 200 قطعه جوجه ی گوشتی سویه ی تجاری راس 308 در قالب طرح کاملا تصافی با 5 تیمار، 4 تکرار و 10 قطعه جوجه در هر تکرار استفاده شد.  پنج تیمار آزمایشی عبارت بودند از:  1- جیره ی شاهد (جیره ی پایه بدون هیچ گونه افزودنی)، 2- جیره ی پایه به همراه 200 میلی گرم بر کیلوگرم ویتامین E، 3- جیره ی پایه به همراه 100 میلی گرم بر کیلوگرم عصاره ی پسته ی وحشی، 4- جیره ی پایه به همراه 100 میلی گرم بر کیلوگرم عصاره ی خرفه، 5- جیره ی پایه به همراه 100 میلی گرم بر کیلوگرم عصاره ی پسته ی وحشی و 100 میلی گرم بر کیلوگرم عصاره ی خرفه بود.  در انتهای آزمایش دو مرغ از هر تکرار کشتار شده و کبد آن ها سریعا جدا گردید و به همراه ازت مایع به آزمایشگاه منتقل گردید.  بیان ژن های آنزیم های سوپر اکسید دیسموتاز و کاتالاز به روش Real-time qPCR ارزیابی شد.  در این روش ژن بتااکتین به عنوان ژن خانگی (منبع) جهت نرمال نمودن داده ها استفاده شده است.  نتایج نشان دهنده ی این است که بیان ژن های آنزیم های سوپر اکسید دیسموتاز و کاتالاز بین تیمارها اختلاف معنی داری دارند.  همچنین در بیان ژن آنزیم های آنتی اکسیدانی سوپراکسید دیسموتاز و کاتالاز، بیش ترین میزان را تیمار 5 داشت.  البته بیان این ژن ها در سایر تیمارها (تیمار 2 و 3 و 4) نسبت به کنترل افزایش معنی داری را نشان داد.  بنابراین نتایج نشان داد که ترکیب عصاره ی پسته ی وحشی و گیاه خرفه در کنار هم می تواند تاثیر به سزایی بر بیان ژن های آنزیم های آنتی اکسیدانی در شرایط استرس گرمایی داشته باشد.

    کلید واژگان: بیان ژن، آنزیم های آنتی اکسیدانی، تنش گرمایی، جوجه های گوشتی
    Molood Rabieh, Hedayatollah Roshanfekr, Mahmood Nazari *, Mohammad Ghorbani

    This study was conducted to assess the gene expression of antioxidant enzymes (superoxide dismutase and catalase) in broiler chickens under heat stress. For this purpose, 200 Ross 308 broiler chicks in a completely randomized design with 5 treatments, 4 replicates and 10 chicks were used in each replicate. The treatments included: 1- control diet (base diet without any additives), 2- basal diet plus 200 mg / kg vitamin E, 3- basal diet plus 100 mg / kg of wild pistachio extract, 4- basal diet with 100 mg / kg of Common Purslane extract, 5- basal diet plus 100 mg / kg of wild pistachio extract and 100 mg / kg of Common Purslane extract. After 42 days, at the end of testing two chickens each replicate were slaughtered and their livers were excised quickly and transported with liquid nitrogen to the laboratory. The expression of the enzymes catalase and superoxide dismutase were evaluated by Real-time qPCR. In this way as beta-actin gene as housekeeping gene is used to normalize the data. The results indicate that the expression of antioxidant enzymes superoxide dismutase and catalase, included the highest level in the 5 treatments. Moreover, the expression of these genes showed a significant increase compared to the control in other treatments (treatments 2, 3 and 4). Therefore, the results indicated that the combination of extracts of wild pistachio and purslane can be together to be great impact on gene expression of antioxidant enzyme than the other groups under heat stress condition.

    Keywords: Gene expression, Antioxidant enzymes, broiler, Heat stress
  • فاطمه بانکی زاده، هدایت الله روشنفکر، محمدحسین بناء بازی*، محمود نظری

    کرچی یک رفتار مادری و غریزه طبیعی در پرندگان است که تولید تخم را مهار می کند. بوقلمون یکی از پرندگانی است که بروز کرچی ممکن است بخش عمده ای از طول عمر اقتصادی آن را شامل شده و و سودآوری اقتصادی صنعت پرورش آن را به میزان قابل توجهی تاثیر قرار دهد. زمینه ژنتیکی و عوامل محیطی و مدیریتی موثر بر بروزکرچی در طیور بخوبی شناسایی و به طور گسترده مورد مطالعه قرار گرفته اند. اما سازوکار تنظیم مولکولی آن بطور کامل مشخص نیست. در مطالعه حاضر ترانسکریپتوم هیپوفیز بوقلمون مادر تجاری از نژاد بیوتی طی مراحل تخمگذاری و کرچی مورد بررسی قرار گرفت. تعداد 334 ژن متفاوت بیان شده بین دو گروه تشخیص داده شد، که 229 ژن دارای بیان زیاد و 105 ژن دارای بیان کم در گروه تخمگذار در مقایسه با گروه کرچ مشاهده شد. در این مطالعه  نتایج آنالیز عملکرد ژن ها با استفاده از پایگاه KEGG نشان داد که ژن های مسیر پردازش پروتئین در شبکه آندوپلاسمی نقش موثری در کنترل کرچی بوقلمون ها داشتند (P <0.05). آنالیز شبکه ژنی نشان داد که ژن های CANX، HSPA8، P4HB، HSPBP1 و ATF4 ممکن است به عنوان تعدیل کننده های مهم هورمونی و سازوکارهای رفتاری مرتبط با کرچی عمل کنند.

    کلید واژگان: هیپوفیز، رونوشت، کرچی، تخمگذار، بیان ژن
    Fatemeh Bankizadeh, Hedayatollah Roshanfekr, MohammadHossein Banabazi *, Mahmood Nazari

    Broodiness, a maternal behavior and instinct for natural breeding in poultry, inhibits egg production. The turkey is one of the most important species having strong broody behavior and affects the poultry of its industry. Broody genetic and environmental factors influencing broodiness in poultry have been extensively studied, but the molecular regulation mechanism of broodiness is somewhat unclear. In this research, pituitary transcriptome of commercial turkey broiler from BUT breed was studied during the laying and broodiness phases. A total of 334 differentially expressed genes were identified. There were 229 upregulated and 104 downregulated at egg-laying phases compared with brooding phases. In the present study analysis of genes using KEGG software revealed that the genes in the Protein processing in endoplasmic reticulum pathway (P <0.05) are critical for controlling broodiness in the turkeys. Gene network analysis revealed that CANX, HSPA8, P4HB, HSPBP1 and ATF4 may act as important modulators of hormonal and behavioral mechanism associated with broodiness.

    Keywords: Pituitary, Transcriptom, Broodiness, Egg Laying, Gene expression
  • سمیرا درخشانفرد*، امیرمسعود صالحی، محمود نظری، سحر قنبری
    مقدمه و هدف

    در عصر پیشرفت تکنولوژی، توجه به رویکرد فناوری در زمینه آموزشی یک ضرورت است نه انتخاب. اهمیت توجه به رویکرد فناوری در دانشگاه های علوم پزشکی محسوس تر است چرا که همه ساله تعدادی از اطلاعات جدید جایگزین اطلاعات قبلی می شود و اگر دانشگاه بخواهد این اطلاعات سریع را در کمترین زمان منتقل کند نیازمند روش نوین در آموزش است چرا که روش های سنتی پاسخگوی انتقال اطلاعات با این حجم نیست بنابراین هدف این مطالعه، تعیین موانع توسعه آموزش مجازی در دانشگاه علوم پزشکی ارومیه از دیدگاه اعضای هیات علمی بود.

    روش ها

    جامعه آماری این پژوهش را همه اعضای هیآت علمی دانشگاه علوم پزشکی ارومیه در سال 1396 تشکیل می داد که از بین آنها نمونه ای به حجم137 نفر به روش تصادفی طبقه ای متناسب انتخاب شدند. ابزار جمع آوری داده ها پرسشنامه محقق ساخته بود که روایی آن از نظر صاحب نظران تایید گردید و پایایی آن با استفاده از آلفای کرانباخ 89% می باشد. اطلاعات با نرم افزار آماری SPSS نسخه 19 به روش تحلیل عاملی اکتشافی تجزیه و تحلیل شد.

    یافته ها

    نتایج نشان داد که درصد تجمعی واریانس برای 8 عامل 575/62 درصد می باشد که مانع پشتیبانی و فنی با 720/9 درصد بیشترین سهم از درصد واریانس را تبیین کرد و مانع فرهنگی با 315/3 درصد کمترین سهم از درصد واریانس را به خود اختصاص داد.

    نتیجه گیری

    از دیدگاه اعضای هیات علمی عامل پشتیبانی و فنی مهم ترین مانع محسوب می شود بنابراین با افزایش سرعت اینترنت، جایگزین کردن سیستم های جدید به جای سیستم های از کار افتاده و تقویت زیرساخت های تکنولوژیکی می توان عوامل بازدارنده استفاده از آموزش مجازی را تقلیل داد.

    کلید واژگان: آموزش، دانشگاه، مجازی
    Samira Derakhshanfard*, Amirmassod Salehi, Mahmood Nazari, Sahar Ghanbari
    Introduction

    In the era of technological promotion, considering technological approaches in education is a necessity, not a choice. The importance of paying attention to such approaches in universities of medical sciences is more obvious, because new information replaces previous ones constantly and if universities wish to transfer this information in the shortest time, there is a need for modern teaching methods, as traditional methods do not account for the transmission of such large volume of information. The purpose of this study was to investigate the barriers of developing virtual education in Urmia University of Medical Sciences from the viewpoint of faculty members.

    Method

    The statistical population of this research consisted of all the faculty members of Urmia University of Medical Sciences in 2017, from which 137 subjects were selected randomly. The data collection tool was a questionnaire whose validity was confirmed by experts and its reliability by Cronbachchr('39')s alpha (89%). The Data was analyzed using SPSS software version 19.

    Results

    The results showed that the cumulative percentage of variance for the eight factors was 62/575 percent, which prevented technical support with 9/720 percent of the major share of the variance percentage, and cultural barrier with 3/315 percent of the lowest share of the percentage of variance Allocated.

    Conclusion

    According to faculty members, technical support was considered the most important barrier so with the increasing speed of the Internet, new systems must be replaced for disabled ones and through strengthening technological infrastructures, hindering factors for application of virtual learning is reduced.

    Keywords: Virtual, University, Education
  • راضیه صباحی، محمود نظری*، محمدتقی بیگی نصیری، محمدرضا قربانی

    هورمون آزادکننده گنادوتروپین ها (GnRH) یک مولکول تنظیم کننده کلیدی در محور هیپوفیز-هیپوتالاموس است که رونویسی هورمون لوتیینه کننده (LH) در هیپوفیز را القاء می کند. تحقیقات نشان داده که استروژن نقش مهمی در تنظیم GnRH ایفا می کند. همچنین آزمایشات اخیر نشان داده که گیاه پنج انگشت حاوی مقدار زیادی فیتواستروژن است. از این رو، در مطالعه حاضر به بررسی اثر پودر میوه گیاه پنج انگشت بر بیان ژن GnRH و LH در مرغان تخمگذار با استفاده از تکنیک Real time qPCR پرداخته شد. برای انجام این آزمایش از 90 قطعه مرغ تخمگذار سویه تجاری های لاین (W-36) از سن 72 تا 80 هفتگی در قالب یک طرح کاملا تصادفی با 3 تیمار، 5 تکرار و 6 قطعه مرغ در هر تکرار به مدت 56 روز استفاده شد. سه تیمار آزمایشی عبارت بودند از: 1- جیره شاهد (جیره پایه بدون هیچ افزودنی)، 2- جیره پایه به همراه 1 درصد پودر میوه گیاه پنج انگشت، 3- جیره پایه به همراه 2 درصد پودر میوه گیاه پنج انگشت. در انتهای آزمایش یک مرغ از هر تکرار کشتار شد، هیپوتالاموس آن ها جدا و به آزمایشگاه منتقل گردید. سپس RNA استخراج شده و برای سنتز cDNA مورد استفاده قرار گرفت. نتایج تجزیه واریانس نشان داد بیان ژن GnRH در تیمار 3 (جیره حاوی 2 درصد پودر میوه گیاه پنج انگشت) نسبت به شاهد و تیمار 1 درصد افزایش معنی داری داشت (0/01>p)، در حالی که افزودن پودر میوه گیاه پنج انگشت به میزان 1 درصد تآثیر معنی داری بر بیان ژن GnRH نداشت (0/05 < p). علاوه براین افزودن 1 و 2 درصد پودر میوه گیاه پنج انگشت تاثیر معنی داری بر بیان ژن LH نداشت (0/05 < p). نتایج این تحقیق نشان داد که افزودن پودر میوه گیاه پنج انگشت به میزان 2 درصد نمی تواند بر محور هیپوفیز-هیپوتالاموس مرغ تخمگذار در سنین 72 تا 80 هفتگی تاثیرگذار باشد.

    کلید واژگان: بیان ژن، فیتواستروژن، گیاه پنج انگشت، GnRH
    Razieh Sabahi, Mahmood Nazari*, MohamadTaghi Beigi Nassiri, MohamadReza Ghorbani

    Gonadotropin-releasing hormone (GnRH) is a key regulatory molecule of the hypothalamus–pituitary gonadal axis which induces transcription of luteinizing hormone (LH) from the anterior pituitary. Research has shown that estrogen plays an important role in regulating GnRH. Also, recent experiments indicated that Vitex agnus-castus (VAC) has high levels of phytoestrogen. Hence, this research was performed to investigate the effect of Vitex Agnuse Castus (VAC) fruit powder on GnRH and LH genes expression in laying hens using Real time qPCR technique. For this purpose, 90 Hy-line W-36 leghorn (at 72 to 80 weeks old) were used in a completely randomized design with 3 treatments, 5 replicates and 6 hens per replicate for 56 days as an experimental period. The three experimental treatments were: 1- control diet (basal diet without any additives), 2- basal diet plus 1% VAC fruit powder, 3- Basal diet plus 2% VAC fruit powder. At the end of the experiment one hens were slaughtered and their hypothalamus was rapidly separated and transferred to the laboratory with liquid nitrogen. Then, RNA was extracted and used for cDNA synthesis. Finally, GnRH gene expression was evaluated by Real-Time qPCR. The ANOVA results showed that GnRH gene expression was significantly increased in treatment 3 (diet containing 2% VAC) compared to the control and 1% VAC groups (P <0.01). While, addition of 1% VAC fruit powder to diet had no significant effect on GnRH gene expression (P> 0.05). Furthermore, addition of 1 or 2 % VOC fruit powder had no significant effect on LH gene expression (P> 0.05). The results of this study showed that the addition of VOC fruit powder fruit powder up to 2% level could not affect the pituitary-hypothalamic axis of laying hens at 72 to 80 weeks old.

    Keywords: GnRH, Gene expression, Phytoestrogen, Vitex Agnuse Castus
  • مرضیه روحی پور، محمود نظری*، محمدتقی بیگی نصیری

    بزها گونه های اهلی با سازگاری بالا هستند و به عنوان سرمایه های ژنتیکی برای بشر در سراسر دنیا مطرح می باشند. محافظت و شناسایی تنوع ژنتیکی در این جمعیت ها بدلیل خطر کاهش شدید، لازم و ضروری است. بز عدنی جزء دام های شیری سازگار با مناطق گرمسیری در کشور محسوب می شودکه در معرض خطر انقراض قرار دارد. لذا این آزمایش به منظور تجزیه وتحلیل ژنتیکی و بررسی روابط فیلوژنتیکی و شناسایی منشا مادری این جمعیت با اسفاده از توالی ناحیه HVR1 ژنوم میتوکندری انجام شد. برای رسیدن به این هدف، از 12 راس بز عدنی از استان بوشهر خونگیری انجام گردید. پس از استخراجDNA  ، یک قطعه 968 جفت بازی توسط پرایمرهای اختصاصی با استفاده از روش PCR تکثیر و توالی یابی شد. نتایج تنوع ژنتیکی10 هاپلوتیپ بر اساس 42 جایگاه متفاوت را نشان داد. بعلاوه، تنوع هاپلوتیپی و نوکلیوتیدی بترتیب برابر 954/0 و0123/0 به دست آمد. این نتایج نشاندهنده تنوع ژنتیکی بالا در بز عدنی است. نتایج فیلوژنتیکی با استفاده از روش  NJنشان داد که بز عدنی با نژاد عفار از کشور اتیوپی قرابت ژنتیکی بالایی دارد و در هاپلوگروپ A طبقه بندی می شود که دلیل آن می تواند موقعیت جغرافیایی استان بوشهر و واقع شدن آن در کنار خلیج فارس و دریای عمان باشد.

    کلید واژگان: بز عدنی، ژنوم میتوکندری، فیلوژنتیک، HVR1
    Marzieh Rohipoor, Mahmood Nazari*, Mohamadtagi Beigi Nassiri

    Goats are highly adapted domesticated species and are considered as genetic resources for human beings around the world. Protecting and identifying genetic diversity in goat populations is imperative because of the risk of a severe decline. The Adani dairy goat is one of the most important indigenous goat breeds of Iran and is reared in the coastal area of the Persian Gulf in Boushehr province. In spite of high temperatures, humidity and low quality and quantity pastures, the breed has been well adapted to the harsh environmental conditions. Considering the importance of conservation of indigenous breeds adapted to harsh environmental conditions, the objective of the current study was to determine the maternal line and the phylogenetic relationship Adani goat breed using hyper variable region 1 (HVR 1). For this purpose, blood samples were collected from 12 Adani goats of Bushehr province. After DNA extraction, a 968 base pair fragment was amplified by specific primers using the PCR method and sequenced. Analysis of HVR1 sequences showed 10 haplotypes with 42 different positions. Moreover, the haplotype and nucleotide diversity based on HVR1 region were estimated 0.954 and 0.0123, respectively. These results indicate high genetic variation in Adani goat. The phylogenetic tree pattern revealed that the Adani goat was clustered with Afar breed from Ethiopia and also, was classified into haplogroup A. This could be due to the geographical location of Bushehr province and its location next to the Persian Gulf and the Sea of Oman.

    Keywords: Adani goat, mt DNA, Phylogenetic, HVR 1
  • کی آر ام کوه گیوی، هدایت الله روشنفکر، محمود نظری*، احمد طاطار
    این تحقیق به منظور بررسی اثر سطوح مختلف پروتئین (20 و 24 درصد) و جایگزینی DL متیونین با L متیونین، بر بیان ژن های میوژنیک (آتروژین-1 و MYF-5) با اسفاده از تکنیک RT-qPCR در بلدرچین ژاپنی انجام شد.  این آزمایش به صورت فاکتوریل 2×2 در قالب طرح کاملا تصادفی با چهار تیمار و چهار تکرار و 15 قطعه بلدرچین در هر تکرار به اجرا در آمد.  تیمار اول شامل DL متیونین و پروتئین 20 درصد بوده که گروه کنترل ما بود.  تیمار دوم شامل L متیونین و پروتئین 24 درصد، همچنین تیمار سوم شامل L متیونین و پروتئین 20 درصد بوده و تیمار چهارم شامل DL متیونین و پروتئین 24 درصد بودند.  پس از 35 روز تغذیه و نگهداری بلدرچین ها، به دنبال 8 ساعت گرسنگی، از هر تکرار 2 بلدرچین کشتار و قطعه ای از بافت ماهیچه سینه ی آن ها به همراه ازت مایع به آزمایشگاه منتقل و در دمای 80- سانتی گراد ذخیره شدند.  پس از استخراج RNA کل، کیفیت آن اندازه گیری گردید و برای تولید و سنتز cDNA مورد استفاده قرار گرفت.  در نهایت بیان ژن های آتروژین-1 و MYF-5 با استفاده از تکنیک Real-time qPCR ارزیابی شد.  در این روش ژن بتااکتین به عنوان ژن خانه دار (منبع) جهت نرمال نمودن داده ها استفاده شد.  نتایج این آزمایش نشان داد که با کاهش سطح پروتئین از 24 درصد به 20 درصد  بیان ژن آتروژین-1 افزایش و بیان ژن MYF-5 کاهش پیدا کرده است.  به علاوه، جایگزینی DL متیونین با L متیونین تاثیری بر بیان ژن های آتروژین-1 و MYF-5 ندارد.  نتایج بیان کننده ی این موضوع بود که می توان DL متیونین جیره را با L متیونین در جیره ی بلدرچین ژاپنی جایگزین کرد و سطح پروتئین 24 درصد در جیره از 20 درصد مناسب تر است.
    کلید واژگان: بلدرچین ژاپنی، بیان ژن، آتروژین-1 و ژن های میوژنیک
    Kei Aram Koohgivi, Hedayatollah Roshanfekr, Mahmood Nazari *, Ahmad Tatar
    This research was conducted to investigate the effect of different levels of protein (20 and 24%) and the replacement of methionine DL with L methionine on the expression of myogenic genes (atrogin-1 and MYF-5) using the RT-qPCR technique in Japanese quail. This experiment was done in the form of a 2×2 factorial with 4 treatments and 4 repetitions and 15 quail in each replicate. The first treatment included DL-methionine and 20% protein (control group). The second treatment consisted of L methionine and 24% proteins, and the third treatment included L methionine and protein 20% and the fourth treatment included DL-methionine and protein 24%. After 35 days of feeding and keeping the quails, with 8 hours interval of hunger, 2 quails were slaughtered in each replicate, and a piece of their chest has been removed immediately and was transferred to the laboratory with Liquid nitrogen, and froze in -80°c. After extraction of the whole RNA, its quality was measured and was used to generate and synthesis the cDNA. Eventually, the expression of myogenic genes was measured by the real-time PCR method. In this method, 𝜷-actin gene, as the source gene, was used to normalize the data. The results showed that by decreasing the protein level from 24% to 20%, atrogin-1 gene expression increased and the MYF-5 gene expression decreased. Also, the replacement of methionine DL with L-methionine did not have a significant effect on the expression of myogenic genes. The results indicated that DL-methionine could be replaced with L methionine, and a 24% protein level is more suitable than 20% in the Japanese quail diet.
    Keywords: Japanese quail, Atrogin-1, Gene expression, Myogenic genes
  • سکینه هزارسی بوری*، محمدتقی بیگی نصیری، هدایت الله روشنفکر، محمود نظری

    در مطالعه حاضر برای شناسایی چند شکلی ناحیه اگزون 2 ژن MHC (مجتمع اصلی سازگاری بافتی) و ارتباط آن با صفات رشد (وزن تولد و سه ماهگی) در جمعیت بز عدنی، از تعداد 97 راس بزعدنی استان بوشهر خون‏گیری انجام گرفت. DNA ژنومی از نمونه‏های خون استخراج و قطعه ‏ای به اندازه 279 جفت باز از ناحیه اگزون 2 ژن MHC با استفاده از واکنش زنجیره‏ای پلی‏مراز (PCR) تکثیر و محصولات PCR به دست آمده به وسیله آنزیم برشی Ras I هضم شدند. نتایج بدست آمده حاکی از وجود 4 نوع آلل A، B، C و D در این جایگاه بود که فراوانی آن‏ها در کل جمعیت به ترتیب 51، 8/26، 4/13 و 8/8 درصد محاسبه شد. تعداد 5 ژنوتیپ AA، AB،BB ، AC و AD شناسایی شدند که فراوانی ژنوتیپی محاسبه شده آن‏ها در جمعیت به ترتیب برابر 432/14، 866/28، 371/12، 80/26 و 52/17 درصد بود.‏‏ نتایج نشان دهنده ‏ی وجود چند شکلی و میزان هتروزیگوسیتی بالا در جمعیت مورد مطالعه ابود. تعداد آلل موثر، شاخص شانون، هتروزیگوسیتی مورد‏انتظار و مشاهده شده برای این جایگاه به ترتیب 794/2، 179/1، 642/0 و732/0 محاسبه شد. بعلاوه، آزمون کای مربع نشان داد که جمعیت در جایگاه MHC-DRB1 در تعادل هاردی-‏وینبرگ قرار ندارد. نتایج نشان داد که تاثیر ژنوتیپ ‏های مختلف بر وزن تولد معنی‏ دار بود (05/0p<) اما بر وزن سه ماهگی معنی‏ دار نبود (05/0< p). بعلاوه، سایر صفات مثل سن مادر، جنسیت، فصل و تیپ تولد روی هیچ کدام از صفات رشد بدن معنی‏ دار نشد (05/0<p). بیشترین وزن تولد مربوط به ژنوتیپ‏ های هتروزیگوت AC و AD (05/3 و 02/3 کیلوگرم) و کمترین وزن تولد مربوط به ژنوتیپ خالص AA (75/1 کیلوگرم) بود. به نظر می‏رسد با انتخاب ژنوتیپ AC و AD بتوان افزایش وزن تولد را در بز عدنی انتظار داشت. همچنین  می توان از این ژن به عنوان یک ژن کاندیدا برای بهبود ژنتیکی برخی از صفات رشد در برنامه های اصلاح نژادی بز مورد توجه قرار گیرد.

    کلید واژگان: چند شکلی، ژنMHC، بز عدنی، PCR-RFLP
    Sakineh Hezarsi Bori*, Mohammad Taghi Beigi Nassiri, Hedayatallah Roshanfekr, Mahmood Nazari

    In the present study, blood samples were collected from 97 Adani goat from Bushehr province in order to identify the polymorphism in the exon II region of MHC-DRB1 gene (Major Histocompatibility Complex) and also, its association with growth traits (birth weight and 3 months weight). Genomic DNA was extracted from blood samples. A 279-bp fragment was amplified using polymerase chain reaction (PCR). Eventually, the PCR products were digested by RasI enzyme. The results showed that there were 4 types of alleles A, B, C and D in this locus with the frequencies of %51, %26.8, %13.4 and %8.8, respectively. Five genotypes including AA, AB, BB, AC and AD were identified with the frequency of %14.432, %28.866, %12.371, %26.80 and %17.525, respectively. The results indicated polymorphism and high heterozygosity in the population under study. Also, the number of effective alleles, Shannon index, expected and observed heterozygosity for this site was calculated at 2.794, 1.179, 0.642 and 0.732, respectively. Moreover, the chi-square (χ2) test showed that population was not in Hardy-Weinberg equilibrium. The ANOVA results showed that the effect of different genotypes on birth weight was significant (p<0.05), but it was not significant on 3 MW (p<0.05). Furthermore, other traits such as dam age, sex, season and birth type effects were not significant on the growth traits (p<0.05). The highest birth weight was found for heterozygous AC and AD genotypes (3.05 and 3.02 Kg, respectively), and the lowest birth weight was related to pure AA genotype (1.75 Kg). It seems that selecting AC and AD genotypes can be expected to increase birth weight in Adani goat. Also, we expect that this gene can act as a candidate gene for genetic improvement of some growth traits in goat breeding programs.

    Keywords: Polymorphism, MHC Gene, RFLP, Adani Goat
نمایش عناوین بیشتر...
بدانید!
  • در این صفحه نام مورد نظر در اسامی نویسندگان مقالات جستجو می‌شود. ممکن است نتایج شامل مطالب نویسندگان هم نام و حتی در رشته‌های مختلف باشد.
  • همه مقالات ترجمه فارسی یا انگلیسی ندارند پس ممکن است مقالاتی باشند که نام نویسنده مورد نظر شما به صورت معادل فارسی یا انگلیسی آن درج شده باشد. در صفحه جستجوی پیشرفته می‌توانید همزمان نام فارسی و انگلیسی نویسنده را درج نمایید.
  • در صورتی که می‌خواهید جستجو را با شرایط متفاوت تکرار کنید به صفحه جستجوی پیشرفته مطالب نشریات مراجعه کنید.
درخواست پشتیبانی - گزارش اشکال