محمود نظری

Zinc is one of the most limiting trace mineral elements required for body growth, structure, hormonal and enzyme activity, nutrient metabolism, cell division, and immune system function. Zinc deficiency has been associated with reduced food intake, stunted growth, and decreased production of IGF-1 in the liver. Zinc plays a key role in the regulation of IGF family gene expression in various tissues and is also effective in desaturating linoleic acid, thereby preventing lipid peroxidation. There is a significant relationship between fat metabolism and zinc. On the other hand, flaxseed oil contains the essential fatty acid alpha-linolenic acid (omega-3), which appears to be related to IGF-1 function in the body. Therefore, this research investigated the effect of adding a zinc-methionine organic supplement to diets with and without the calcium salt of flaxseed oil on IGF-1 gene expression in the liver tissue of fattening lambs.

In this research, 44 Arab male lambs were used in a 2 x 2 factorial experiment within a completely randomized design, with four treatments and 11 replications. The four experimental diets were: 1) basic diet without Ca-salt of flaxseed oil supplement and without zinc-methionine supplement (CON), 2) basic diet without Ca-salt of flaxseed oil supplement containing 0.08% zinc-methionine supplement, 3) basic diet containing 3% Ca-salt of flaxseed oil supplement without zinc-methionine supplement, and 4) basic diet containing 3% Ca-salt of flaxseed oil supplement plus 0.08% zinc-methionine supplement. After the fattening period, three lambs from each treatment were slaughtered, and muscle tissue was transferred to the laboratory with liquid nitrogen. After RNA extraction and quality assessment, cDNA synthesis was performed. The expression of lipogenic genes was evaluated using the Real-time PCR method.

The presence of a single band in the range of 240 base pairs for the IGF-1 gene and 144 base pairs for the GAPDH gene on gel electrophoresis confirmed the accuracy of the test and the correct amplification of the desired fragments by polymerase chain reaction. The presence of a single peak in the melting curves of the IGF-1 and GAPDH genes in the real-time PCR reaction further confirmed the specificity of the produced products. The results showed that the addition of zinc supplements significantly increased the expression of the IGF-1 gene (P < 0.01), from 1 to 4.95. Additionally, the calcium salt of flaxseed oil supplement significantly increased IGF-1 gene expression (P < 0.01), raising it from 1 to 3.52. The interaction effects of the zinc-methionine supplement and calcium salt flax oil supplement were not significant. Simultaneous addition of the zinc-methionine supplement and the calcium salt flax oil supplement to the diet of fattening lambs increased IGF-1 gene expression in the liver.

The addition of a zinc-methionine organic supplement to diets containing a calcium salt flaxseed oil supplement increases IGF-1 gene expression. Increasing IGF-1 gene expression will likely enhance growth and overall production.

The sex of chickens considerably impacts production performance and economic benefits in poultry farming. Male birds cannot lay eggs and usually have a lower ratio of meat to feed than broilers. Male chicks are typically killed immediately after hatching since they are redundant in the industry and male chicks will neither be suitable for egg production nor meat production. Day-old male chicks in the laying hen industry are usually culled immediately after hatching. As a result, this issue has caused moral concerns in societies. Efforts are underway to develop technology for automatically determining the sex of chick embryos, aimed at establishing a stable and efficient poultry farming system. In large commercial hatcheries, the sexing of newly born chicks is generally accomplished by three different methods according to new hatching lines' vent, color, or feathers. However, these methods are still time- and labor-consuming. If sex can be identified at an early embryonic stage or even before incubation, male eggs could be used as feed components. Moreover, fewer eggs would need to be incubated, which would reduce feed space requirements, CO2 emissions, and energy consumption, which are all economically beneficial to farmers and the environment. In recent decades, researchers have used various in ovo sexing strategies in chicken eggs before hatching or incubation. Some invasive and noninvasive studies that have been conducted for in ovo sexing of chicken eggs can be divided into five major categories: (i) molecular-based techniques, (ii) spectral-based techniques (Raman spectroscopy, fluorescent, 3D X-ray), (iii) acoustic-based techniques, (iv) morphology-based techniques, and (v) volatile organic compound (VOC)-based techniques. Commercially applicable methods must be noninvasive, rapid enough for real-time applications, economically feasible, and ethically acceptable. An alternative method, to prevent the removal of day-old chicks, is a non-invasive method to determine the sex of the egg in the early stages of hatching before the development of the nervous system. Recently, Raman spectroscopy was reported to determine the sex of eggs at the incubation stage. Raman spectroscopy is based on the Raman effect, whereby when incident light (wavelength 750–850 nm) excites molecules in a tissue, the molecules reflect light at a different wavelength. The reflected light's wavelength is characteristic of various chemical components and allows the detection of the atheromatous plaque chemical synthesis. Raman spectroscopy is a powerful tool expected to revolutionize chick sex determination because it can provide information about biological molecules. Thus, Raman spectroscopy is suitable for analyzing living organisms, leading to its widespread adoption across various biological and medical applications. Therefore, resonance Raman spectroscopies have found application in blood analysis, with some studies exploring its utility in chick sexing. For this purpose, the present study was carried out to investigate the feasibility of determining the sex of Iranian native chicken embryos using the Raman spectroscopy. To carry out this research, 100 fertilized eggs of Iranian native chickens were used. The sex of the embryos was determined using Raman spectroscopy with a wavelength of 785 nm during the fourth day of incubation. Validation of this method was investigated using the polymerase chain reaction (PCR) technique. Sequence alignment of CHD-Z and CHD-W allele sequences amplified by PCR technique. The amplified DNA fragments were single and double DNA bands in the size of 461 bp for the CHD-Z and 322 bp for the CHD-W genes. The PCR was carried out using a PCR master kit with specific primers (the forward primer: 5′- TATCGTCAGTTTCCTTTTCAGGT -3′, the reverse primer: 5′- CCTTTTATTGATCCATCAAGCCT -3′). Thermal cycling conditions for DNA amplification were: 1 cycle of initial denaturation at 94°C for 5 minutes; 35 cycles comprising 30s at 94°C for the denaturation, 30s at 59°C for annealing, 30s at 72°C for the elongation; and a final extension cycle at 72°C for 5 minutes. The PCR products were analyzed by electrophoresis on 2.5% agarose gel against a DNA Ladder 100bp, and visualized using the safe staining on UV transilluminator. The data obtained from the Raman spectrometer was analyzed using the Origin software. The main indices used to study the data were the intensity of the Raman peaks and the ratio of the dominant peak intensity. Additionally, principal component analysis (PCA) was employed to identify any patterns in the data. To calculate PCA1 and PC2, the ratios of I769/I838 and I1141/I1251 peaks were considered, respectively. PCA analysis can choose features that have a greater impact on the final result, depending on the data and the scope of their changes. The result of PCR showed that one fragment with a length of 461 bp was amplified for male embryos (ZZ) and two fragments with lengths of 461 and 322 bp were amplified for female embryos (ZW(. The study found that there are differences in the intensity of Raman bands between genders. Males have higher intensity while females have lower intensity. Therefore, changes in Raman spectra intensity can be used to identify gender. Additionally, the candlestick chart of the data showed that median and average values for males were larger than for females. Furthermore, the results obtained from PCA analysis showed that the variance percentages for PC1 and PC2 were 53.69% and 46.31%, respectively. PC2 is more reliable as it has less deviation. Based on the results obtained from the study, it can be concluded that Raman spectroscopy is a reliable method for determining the gender of chicken embryos during incubation. This test is quick, accurate, and can be easily incorporated into the industry to determine the gender of embryos without resorting to the practice of killing day-old chicks. Not only is this method more ethical, but it also offers a high level of accuracy, making it an attractive alternative for the industry. In general, these results demonstrate the potential application of hematological traits in developing an automatic in ovo embryo sexing method through spectroscopic analysis.

In order to evaluate cytoplasmic inheritance of growth traits (including birth weight, 3, 6, 9 and 12 month weight), the total number of 19717 Arabic sheep records which was collected by Agricultural Organization of Khuzestan province was used during1989 to 2010. Following the cytoplasmic lines from progeny to the parents, cytoplasmic primary sources were identified. Environmental factors affecting these traits were analyzed by SAS statistical software. Genetic parameters were estimated using Bayesian statistical method and MTGSAM software. Significant effect (P <0.01) on traits including lambs sex, birth type, maternal age and birth year were found. Based on the lowest acacia criteria in Bayesian statistical method, models 5, 5, 3, 4, 3 for birth weight, 3, 6, 9 and 12 months were the best models respectively. The cytoplasmic inheritance for birth weight, 3 months of age was 0.02, 0.03, and for the weights at 6, 9 and 12 months age, there was no cytoplasmic inheritance. However, the observed cytoplasmic variance for birth weight and 3 months old weight in Arab sheep were 0.004, 0.410, respectively, while no cytoplasmic variance for 6 to 12 months old was observed. Generally, although for the weight trait the share of cytoplasmic inheritance was low, but considering maternal effects and cytoplasmic heritages would result in a more accurate estimation of the genetic parameters of the growth traits of all ages.

Bee venom is a liquid, colorless and acidic mixture (pH 4.5-5.5) that contains 18 different compounds such as enzymes, peptides and biological amino acids. Some of these compounds have anti-inflammatory properties and some have toxic and allergenic properties. Bee venom is produced by female worker bees. The most important peptides in bee venom are melittin, apamin, adolapin and mast cell degranulating (MCD) peptide. The most important enzymes in bee venom can be called hyaluronidase and phospholipase A2 (PLA2). Bee venom has been used in the past, especially in traditional medicine, as a medicine to treat various diseases such as rheumatoid arthritis and also to reduce muscle pain.Massive bee attacks are considered one of the Public Health problems in some countries in the world, including Iran. No specific therapy is available for bee stings and the treatment is done by chemical drugs, leading us to develop Fab-based antivenom as a potential new treatment. So far in Iran, no action has been taken to produce Fab-based antivenom to save people who are sensitive to bee stings. Therefore, the aim of this research was to produce an effective and safe horse serum antidote against the Iranian honey bee (Apis mellifera meda).

Crude bee venom (BV) was prepared from Iranian bees (Apis mellifera meda) using an electric bee venom collecting machine. The poison dries quickly in the air. The dried venom was collected from the glass plates every day with the help of special spatulas and stored in dark glasses in a freezer at -20 ºC for future experiments. To remove mucus and extra substances, the poison is dissolved in a ratio of 1:1 with saline (physiological serum) and centrifuged at high speed. After centrifugation, the upper clear solution is separated and filtered with a 0.2 micron filter.The amount of protein in the crude venom solution was determined by the Bradford protein assay method and based on the standard curve obtained by measuring different concentrations of bovine serum albumin (BSA) solution.The median lethal dose (LD50) value of BV was determined with 24 male mice. Mice were divided into 4 groups. Then 0.5 ml of different doses of venom (60, 70, 80, 90, 100 and 110 μg/ml) dissolved in sterile normal saline were injected intravenously. Control group were injected with 0.5 ml saline solution. Mortality was recorded after 24 hours and LD50 was calculated based on probit analysis. In this research, 3 horses were used to produce antivenom against honey bee venom. For this purpose, horses were immunized with Iranian bee venom 7 times with 7-day intervals, and immunogenicity was evaluated in laboratory conditions with ELISA test. The precipitated antivenom with saturated ammonium sulfate was also used to perform the neutralizing test in mice. To check the quality of antivenom, the neutralization of phospholipase A2 activity was performed using different concentrations of antivenom. Finally, for determining the efficiency of the prepared antivenom, the median effective dose (ED50) value was calculated by probit analysis. In this research, three adult mares (three years old, 400 to 450 kg) were used. To immunize the horses, bee venom was injected with complete and incomplete Freund's adjuvant. Complete Freund's adjuvant was used in the first and second inoculations, and incomplete Freund's adjuvant was used in subsequent inoculations. Venom inoculation was carried out incrementally from 50, 100, 250, 500, 1000, 2000 and 4000 micrograms in 7 times with 7 days intervals. The injection was done subcutaneously (in the neck). Isolation of horse antibody was performed with the standard protocol of the saturated ammonium sulfate method. Evaluation of immunogenicity in laboratory conditions was done by ELISA test. The serum of immunized horses and the precipitated antivenom with saturated ammonium sulfate were was also used to perform the neutralizing test in mice. To check the quality of antivenom, the neutralization of phospholipase A2 activity was performed using different concentrations of antivenom. Finally, for determining the efficiency of the prepared antivenom, the median effective dose (ED50) value was calculated by probit analysis. To determine the effectiveness of the prepared horse antivenom, bee venom was mixed with a constant amount of antivenom in increasing doses and injected into mice

The total protein in the crude BV solution was calculated to be 56 mg/ml. Also, the LD50 of the crude BV was obtained as 4.84 μg/g. ELISA test results showed an immune response that increased more during the immunization schedule. Neutralization of phospholipase A2 activity using different concentrations of antivenom showed that Iranian bee venom has phospholipase activity and 120 μg/ml of this antidote is able to completely neutralize the activity of phospholipase A2. It is clear that, firstly, Iranian honey bee venom has phospholipase activity, and secondly, 55 micrograms of antivenom are needed to neutralize 50% of phospholipase A2 activity in 100 micrograms of venom.The ED50 value will be approximately 54 times the LD50. This means that the antivenom can neutralize up to 54 times the LD50. Therefore, the death caused by 4 mg of bee venom is neutralized by 1 ml of antivenom, so the average effective dose ED50 will be 4 mg/ml. If 100 micrograms of venom enters the body in each bee sting, then 1 ml of produced antivenom can neutralize 40 bee stings.

The result showed that horse antivenom against honey bee venom is capable to neutralize the crude venom in mice model.

This research was conducted to identify and validate the simple sequence repeats (SSR) markers related to yellowfin barbel (Luciobarbus xanthopterus) using RNA-Seq data. After collecting the liver tissue, RNA was extracted from the samples. The samples were sequenced using the Illumina Novaseq 6000 platform. Trinity software (version 2.15.1) was used to reconstruct transcripts. Identification of SSR was done using the MISA web server. The primers needed in the polymerase chain reaction for 5 SSR markers were designed by PRIMER 3 software and validated using 45 yellowfin barbel. Transcript assembly by the Trinity program generated 941,894 unigenes and 1,768,662 transcripts. In this study, the examination of 1,276,825 sequences by MISA software led to the identification of 349,871 potential SSR markers. Among the SSRs, di- and trinucleotide repeats had the highest number of repetitions with 89.37% and 8.05%, respectively. From the 5 primers used, only two of them showed polymorphism. The expected and observed heterozygosity for the MN1359 locus were calculated as 0.785 and 0.147, and for the GM1371 locus given 0.770 and 0.093, respectively. Moreover, the chi-square test showed that population was not in Hardy-Weinberg equilibrium. The results of different genetic diversity criteria showed a decrease in diversity in yellowfin barbel. Generally, this research showed that the new SSRs can be helpful for molecular breeding, functional genomics studies, and the genetic diversity analysis of yellowfin barbel.

Alpha-lipoic acid (α-LA) synthesized enzymatically in the mitochondrion from octanoic acid. Endogenous levels of α- lipoic acid have been reported in the micro molar range. Alpha-lipoic acid can easily pass through biological membranes due to its high lipophilicity and is converted into dihydro lipoic acid (DHLA) in cells. Alpha-lipoic acid and DHLA have been described as an ideal antioxidant couple, due to their very high protection ability against oxidative stress through multiple pathways. Alpha-lipoic acid and DHLA have metal chelating activity, acts as a coenzyme in glucose metabolism, and can produce other antioxidants such as ascorbate, vitamin E, and glutathione (GST). Alpha-lipoic acid has anti-inflammatory properties and its supplementation to broiler diets improves the expression of inflammation-related genes in the spleen. On the other hand, trivalent chromium has been recognized as an essential trace element for humans and other animals, which is part of the glucose tolerance factor (GTF). Chromium is essential for the metabolism of carbohydrates, proteins and lipids. Chromium may be present in the diet in the form of inorganic compounds or organic complexes. After absorption, chromium circulates in a free state and binds to transferrin or other plasma proteins (protein β-globulin). Trivalent chromium seems to play a role in the structure and expression of genetic information in animals. Chromium binding to nucleic acids is stronger than other metal ions. Chromium protects RNA against thermal denaturation. It is also clear that chromium is concentrated in the cell nucleus. By binding to chromatin, chromium participates in gene expression and increases the start sites and thus increases RNA synthesis. This increase is due to the induction of protein bound to the nucleus and the activation of nuclear chromatin, as a result, chromium effects gene function. Chromium supplementation has shown a positive effect on immune response of broiler chickens. The aim of this research was to investigate the simultaneous effect of dietary chromium propionate and alpha-lipoic acid supplementation on the expression of cytokines interleukin 1, 2, 4, and 10, as well as IFN-γ, TNF, and TGF β4 genes in the spleen tissue of broiler chickens.

For this purpose, an experiment was performed with 144 Ross 308 broiler chicks in complete randomized design (CRD) with a 3×2 factorial arrangement of treatments including six treatments, 3 replicates and 8 chickens in each replicate. There were 6 dietary treatments: three doses of chromium propionate (0, 750 and 1500 μg / kg) combined with two levels of alpha-lipoic acid (0 and 300 mg/kg) supplemented to the basal diets. At the end of the experimental period (42 days old), two chickens from each pen were randomly selected and killed. The sample was taken from the spleen and immediately frozen in liquid nitrogen and then stored at -80°C. The quantity and purity of the extracted RNA was checked using a Nanodrop device. In order to confirm the specific amplification of the desired genes in this study using primers, the PCR reaction was first performed. The expression of cytokine profile genes were quantified by quantitative real time PCR. In this way, 28S was used as a house-keeping gene to normalize the gene expression data. To analyze the obtained data, the method of difference in threshold degree changes (∆∆CT) was used. The method of investigating gene expression changes in this research was the 2-ΔΔCT method (comparative threshold) and the ratio of gene expression (28s).

The results of electrophoresis confirmed the expression of genes in the spleen cells of broiler chickens and they appeared as one band on 2% agarose gel. Electrophoresis of polymerase chain reaction products showed fragments of 86, 51, 82, and 88bp for interleukin 1, 2, 4, and 10, respectively. No bands were formed on agarose gel for IFN-γ, TNF and TGF β4 genes. The results showed that alpha-lipoic acid at the level of 300 mg/kg significantly decreased interleukin 1 gene expression than the control group (0 mg/kg). Also, supplementing the basal diet with the chromium propionate at the level of 1500 μg/kg significantly increased interleukin 1 and 4 genes expression compared to the control group and the chromium propionate at the level of 750 μg/kg. While the addition of alpha lipoic acid and chromium propionate had no effect on the expression of interleukin 2 and 10 genes.

Adding 300 mg/kg alpha lipoic acid to the diet can improve the immune response by reducing the expression of IL 1 gene in broilers. In addition, the addition of high amounts of chromium propionate (1500 μg) leads to a decrease in immunity (by increasing the expression of IL 1 and 4 genes). While the addition of chromium propionate up to the level of 750 μg/kg does not affect safety. Considering the results, it is recommended to add alpha lipoic acid at the level of 300 mg to the broiler diet. Addition of chromium propionate up to the level of 750 µg is fine if it has beneficial effects on yield and production characteristics.

Myrtle essential oil (MEO) has antimicrobial, antioxidant, and anti-inflammatory effects. Especially, tannins and flavonoids in MEO have antioxidant properties. So, it can be expected that MEO can affect the immune system of broilers. Therefore, in this research, the effect of MEO on the gene expression of cytokines (IL-1, IL-2, IL-4, and IL-10) in the tissues of the small intestine of broiler chickens was investigated. For this purpose, 120 Ross 308 broiler chicks in a completely randomized design with 2 treatments, 5 replicates and 12 chicks were used in each replicate. The treatments included: 1- control diet, 2- basal diet plus 250 mg / kg MEO. After 42 days, at the end of testing one chickens each replicate were slaughtered and their tissues were excised quickly and transported with liquid nitrogen to the laboratory. Quantitative real-time PCR was used to measure the expression of the cytokines. Analysis of variance showed that the addition of 250 mg/kg of the myrtle essential oil (MEO) in the diet of broiler chickens had no significant effect on IL-2 and IL-10 gene expression. While the expression of IL-1 and IL-4 genes had a significant effect. These results indicate that the myrtle essential oil can play a role in the cellular immune response in the small intestine of broiler chicken by reducing pro-inflammatory cytokines. So, the anti-inflammatory aspect of MEO could be used by adding it to the diet of broilers.

Bee venom contains various enzymes such as hyaluronidase and phospholipase A2, which have medical and pharmaceutical applications. In several studies, the activity of phospholipase A2 and hyaluronidase has been reported in different bee species, but there is no report about these enzymes and their activities in Iranian honey bee venom. Therefore, the purpose of this research was to isolate, identify phospholipase A2 and hyaluronidase enzymes and measure their activity in crude venom and its fractions of Iranian honey bee (Apis mellifera meda).

One hundred mg of the crude venom was purified using gel filtration chromatography on sephadex G-50, equilibrated with 0.05mM ammonium acetate buffer. SDS-PAGE was used to determine the protein profile of BV and its fractions. Protein concentration, phospholipase A2 and hyaluronidase enzyme activity of Apis mellifera crude venom and its fractions were measured. Protein concentration of Apis mellifera crude venom and its fractions was determined using Bradford method. Phospholipase A2 (PLA2) activity was determined using suspension of egg yolk as substrate. The activity of hyaluronidase was determined turbidimetrically.

The preliminary results showed that the 56% of crude venom was protein. Crude venom produced three fractions. Phospholipase A2 activity was observed in the crude venom as well as in the first and second fractions. The second fraction showed the highest phospholipase activity. Hyaluronidase activity was observed in crude venom and only in the first fraction. The optimal activity of bee venome phospholipase A2 enzyme was obtained at pH 7 and 37 °C. In this study, it was found that the activity of hyaluronidase in Iranian honey bee venom has the highest activity at 37 to 39 °C and gradually loses its activity as the temperature increases. Also, the results of this study indicate that the optimum pH for hyaluronidase enzyme activity is 5.5.

Iranian honey bee venom has both phospholipase and hyaluronidase activities, which can be separated using gel filtration chromatography. This study can be introduced as a simple method to isolate, purify and measure the activity of hyaluronidase and phospholipase A2 enzymes of Iranian honey bee venom. Purified hyaluronidase and phospholipase A2 enzymes can be used in industry and research.

Estrogen consumption in women can increase the risk of breast cancer. Estrogen stimulates the growth of cancer cells through the estrogen receptor alpha (ERα). One of the strategies that has recently been considered is the use of phytoestrogens. Previous studies have shown that Chaste-berry contains high levels of phytoestrogens. Scientists disagree on whether the phytoestrogens in Chaste-berry are used to treat many diseases in women, which are ERα or ERβ selective. In the present study, laying hens were used as a model to find the answer because only alpha estrogen receptor is expressed in the oviduct. In this study, the effect of Chaste-berry fruit powder on performance, egg quality, immune response, and the expression of GnRH, LH, ovalbumin (OVAL), and ovomucoid (OVM) genes in laying hens were evaluated. A total of 90 leghorns (Hy-Line, W-36) laying hens (at 72 to 80 weeks old) were used in a completely randomized design with three treatments and five replicates (n=6). The treatments were various levels of Chaste-berry fruit powder including zero, 1, and 2% levels of Chaste-berry fruit powder per kg of diet. Our results showed that performance parameters, egg quality factors, and immune responses were not significantly affected by various levels of Chaste-berry fruit powder. Moreover, the results indicated that the various levels of Chaste-berry did not have a significant effect on LH, OVAL, and OVM gene expression. However, GnRH gene expression was significantly increased in treatment 3 (a diet containing 2% Chaste-berry) compared to the control and 1% Chaste-berry groups. Moreover, the addition of 1% Chaste-berry fruit powder to the diet had no significant effect on GnRH gene expression. Therefore, Chaste-berry supplementation is not recommended in laying hens. Furthermore, our data reinforce this theory that phytoestrogens in Chaste-berry fruits are ERβ-selective.

Since finding new drugs with fewer side effects to reduce blood sugar in diabetics seems necessary, the present study aimed to evaluate the effect of the different doses of Capparis spinosa fruit extract on key enzymes of glucose metabolism pathways in the liver cells of diabetic male rats.

In this experimental study, 60 male Wistar rats were randomly divided into 6 groups. Groups 1-3 were normal (nondiabetic) rats that received distilled water, and 200 and 800 mg/kg extract, respectively, and groups 4-6 were diabetic rats that received distilled water, and 200 and 800 mg/kg extract, respectively. Diabetes induced by intraperitoneal injection of 50 mg/kg streptozotocin. Serum levels of insulin and glucose were measured by special kits, the activity of glucokinase and hexokinase was measured manually, and gene expression of phosphofructokinase-1 and glucose-6-phosphatase was determined by Real Time-PCR. Data was analyzed using non-parametric Kruskal-Wallis H test and post hoc Mann-Whitney U test.

Administration of Capparis spinosa fruit extract decreased the serum level of glucose but increased the serum level of insulin and glucokinase and the level of expression of phosphofructokinase-1 genes in all groups receiving the extract compared to the control groups, and the average activity of glucose-6-phosphatase and hexokinase in different groups was significantly different (p<0.001).

The treatment of diabetic animals with Capparis spinosa fruit extract caused a significant decrease in blood sugar and an increase in serum insulin levels, and also led to an improvement in the activity of enzymes involved in glycolysis. Therefore, it seems that the consumption of this fruit has beneficial effects on blood sugar and insulin secretion as well as sugar metabolism.

Phytoestrogens are herbal estrogens with estrogen-like functions and structures. The estrogen hormone has an important role in the process of the synthesis of egg white proteins in the avian oviduct. Vitex agnus-castus (VAC) is a native plant of the middle Asian, southern European, and Mediterranean countries. This plant has numerous uses in traditional medicine and is traditionally used to treat many diseases in women. Previous studies have shown that VAC contains high levels of phytoestrogens. VAC consists of compounds such as vitexin, apigenin, and pendoltin, which are the most active phytoestrogen in VAC fruits. No study has been published so far on the effect of VAC on oviduct markers gene expression (ovalbumin (OVAL) and ovomucoid (OVM)). Hence, this study was performed to evaluate the effect of VAC fruits on gene expression for two oviduct markers OVAL and OVM of laying hens.

A total of 90 leghorns (Hy-Line, W-36) laying hens on the second cycle of production (at 72 to 80 weeks old) were used in a completely randomized design with three treatments, five replicates and six hens per replivate. The treatments were various levels of VAC fruit powder including zero, 1, and 2% levels of VAC fruit powder per kg of diet. After extraction of total RNA, RNA quality was evaluated using Nanodrop and agarose gel electrophoresis and cDNA was synthesized using a Sinaclone kit. Eventually, gene expression was measured by the real-time qPCR method. In this method, 𝜷-actin gene was used as a reference gene to normalize the gene expression data. To confirm the specificity of each primer, its melting curves were examined.

Electrophoresis of the PCR products showed the 60, 133, and 150-bp fragments for OVAL, OVM, and Beta-actin, respectively. Melting peaks analysis on the PCR products for all primers confirmed minimal primer-dimers and primer specificity. The results of the real-time qPCR method indicated that supplementation of VAC fruits powder at levels 1 and 2 to the diet of laying hens has no effect on the expression of OVAL and OVM genes of laying hens in the second production cycle.

Therefore, Adding VAC fruit powder to the diet of laying hens is not expected to increase egg production in laying hens. Therefore, VAC supplementation is not recommended to the diet of laying hens.

The myxovirus (Mx) gene play a crucial role in the antiviral responses of chicken. The Mx gene is a potential candidate as a genetic resistance marker to the avian influenza virus in chickens. This study was conducted to determine the polymorphism of myxovirus gene polymorphism using PCR-RFLP method in Khuzestan native chicken. In this research, blood samples were collected randomly from 100 Khuzestan native chicken (Malasani, Andimeshk and Shush) and DNA were extracted. Polymerase chain reaction (PCR) was used to amplify 299bp fragments of myxovirus (Mx) gene by specific primers. Then, the amplified fragment was digested with HPY8l enzyme. Allele frequency for A and G, in Shoosh 0.54 and 0.46, Mollasani 0.85 and 0.15 and Andimeshk 0.57 and 0.47 and genotype frequencies of AA, GG and AG, in Shoosh 0.40, 0.33 and 0.27, Mollasani 0.8, 0.1 and 0.1 and Andimeshk 0.45, 0.40 and 0.15 were achieved, respectively. The results showed that the frequency of allele A was higher than G. Furthermore, the observed heterozygosity and the effective number of alleles demonstrated low diversity in the population. Chi-square (X2) analysis showed that the locus allele frequencies are not in Hardy-Weinberg equilibrium. The results of this study suggested that the MX gene had polymorphism and had a high potential for use as a genetic marker for resistance to avian influenza and Newcastle disease.

Chicken is one of the most important sources of meat in human societies. One of the important goals of broiler breeding is to reduce the accumulation of fat in broilers. The pathways of peroxisome proliferative activating receptors (PPARs signal pathway) play an important role in fat accumulation. This pathway includes a group of nuclear receptor proteins that play a key role in proliferation, cell differentiation, and metabolism (carbohydrates, lipids, proteins). Therefore, it is important to identify the genes involved in this pathway. This study was performed to predict the microRNAs affecting the peroxisome proliferator receptors (PPARs) with the aim of reducing fat accumulation in broilers. Analysis of the chicken genome reference file in the KEGG database led to the identification of 68 genes involved in the signaling pathway (PPAR). Then, the gene network is drawn by using a STRING network. In addition, protein interaction network analysis was performed using Cytoscape software. Eight genes ACOX1, PPARA, LPL, FABP3, CPT1A, EHHADH, SCD, and PPARGC1 were selected as the most influential genes of the PPAR signaling pathway based on centrality indices (including degree centrality, betweenness centrality, closeness centrality) provided by Cytoscape software. Also, the microRNAs corresponding to these genes was identified using databases: MIRdb and Targetscan. Finally, the MirNet network was utilized for the prediction of target genes and drawing a protein-microRNA interaction network. The results showed that gga-mir-1759-3p affects three genes CPT1A, LPL, and PPARGC1A. Perhaps using this micro-RNA can reduce the accumulation of fat in broiler.

The genetic purity of sheep breeds is declining due to uncontrolled crossbreeding, so it is essential to preserve biodiversity in native breeds as a national asset. Therefore, the purpose of this study was to investigate the genetic and phylogenetic diversity of the mitochondrial HVR I region between the three Taleshi, Makui and Shal breeds. For this purpose, HVR I sequences of these three breeds were downloaded from NCBI database. Nucleotide diversity for Taleshi, Shawl and Makui breeds calculated 0.0416, 0.04552 and 0.04422, respectively, and haplotype diversity in all three breeds was estimated to be 1.00. In addition, the results of molecular analysis of variance (AMOVA) showed that the diversity within populations was about %100 and in fact the total diversity was included and the diversity between populations was %0. These results indicated high genetic variation in three sheep breeds. Negative Tajima''s D for Taleshi breed indicated that the this population is expanding after going through a recent bottleneck and selection sweep is in progress, while positive Tajima''s D for shawl and Makui breeds demonstrated that these two populations are balancing selection. The NJ phylogenetic test results indicated that all three breeds of sheep were classified into haplotype D. From the classification of these breeds with the Caucasian and Turkish breeds in one branch, it can be concluded that these three breeds are the ancient breeds of sheep and more efforts should be made to preserve these national assets.

The spliceosome is a large ribonucleoprotein complex that guides pre-mRNA splicing in eukaryotic cells. In this research, pituitary transcriptome profile of commercial breeder turkey of BUT breed was studied during the laying and broodiness phases. A total of 334 differentially expressed genes during egg-laying phases and brooding phases were identified. There were 229 upregulated and 104 downregulated at egg-laying phases compared with brooding phases. In the present study results of both GO and KEGG analysis suggested that the genes in the spliceosome complex are critical in the transition from the egg-laying to brooding phase turkeys. In addition, in the calcium ion transport in the biological process, splicing activates and creates various isoforms of the calcium/calmodulin alpha, which plays an important role in the neurotransmitter and hormonal systems of turkeys. In this study it was revealed that SNRPD1, SNRPF and SNRPA1/U2A in spliceosome complex were essential for folliculogenesis and fertility. HSPA8 wassignificantly down-regulated at laying turkeys compared with broodiness turkeys was involved in autophagy and follicular regression in broody turkey.

The Diacylglycerol O-Acyltransferase 1 (DGAT1) gene plays a key role in the production of triglycerides and milk fat by encoding the enzyme DGAT1. Recent research has shown that polymorphisms in the DGAT1 gene affect milk production. Therefore, the aim of this study was to investigate polymorphism in exon 14 region of DGAT1 gene in Khuzestan dromedary camels (Camelus dromedarius) using PCR-SSCP method. To perform this experiment, blood samples were collected from 80 dromedary camels in Khuzestan province. After DNA extraction, a 310-bp fragment of exon 14 region of DGAT1 gene was amplified using polymerase chain reaction (PCR). Six different SSCP patterns, including six different genotypes of AA (45%), AB (33.75%), BB (5%), CC (3.75%) , DD (2.5%) and EE (10%) and five alleles including A (0.619), B (0.219), C (0.038), D (0.025) and E (0.1) were identified. Moreover, the chi-square (χ2) test showed that the population was not in Hardy-Weinberg equilibrium. The number of effective alleles, Shannon index, expected and observed heterozygosity for this site was calculated 2.259, 1.07, 0.557 and 0.338, respectively. The results indicated polymorphism and low heterozygosity in the population under study. It is suggested to increase the diversity in the dromedary camel population of Khuzestan by developing appropriate breeding programs.

The DMB2 gene is one of the MHC cluster genes that plays a role in the humoral immune response. This study was performed to identify the polymorphism of exon 2 of the MHC-DMB2 gene and its association with the humoral immune response in Japanese quail. For this purpose, on day 28, 0.2 mL of 5% saline suspension of sheep red blood cell (SRBC) was injected into 130 quail's breast muscle (65 males and 65 females). Seven days later, cervical vein blood sampling was performed on the 35th day. Afterward, the anti-SRBC titer antibody was determined using a micro hemagglutination technique. Also, genomic DNA was extracted from blood samples and a 333bp fragment of exon 2 was amplified using polymerase chain reaction and PCR products were digested by Hinf 1 restriction enzyme. The results showed that there were two types of C (333bp) and G (226, 107bp) alleles in this region with a frequency of 74.6% and 26.4% in the whole population, respectively. The results indicate high polymorphism and high homozygosity in the studied population. In addition, the results showed that genotype had a significant effect on antibody titers (P<0.01). The CC genotype showed the highest total antibody titer (2.13 mg/dL) and the GG genotype showed the lowest total antibody titer (0.33 mg/dL). It is suggested that the negative effects of this single nucleotide polymorphism be considered in breeding programs.

This study was conducted to assess the gene expression of antioxidant enzymes (superoxide dismutase and catalase) in broiler chickens under heat stress. For this purpose, 200 Ross 308 broiler chicks in a completely randomized design with 5 treatments, 4 replicates and 10 chicks were used in each replicate. The treatments included: 1- control diet (base diet without any additives), 2- basal diet plus 200 mg / kg vitamin E, 3- basal diet plus 100 mg / kg of wild pistachio extract, 4- basal diet with 100 mg / kg of Common Purslane extract, 5- basal diet plus 100 mg / kg of wild pistachio extract and 100 mg / kg of Common Purslane extract. After 42 days, at the end of testing two chickens each replicate were slaughtered and their livers were excised quickly and transported with liquid nitrogen to the laboratory. The expression of the enzymes catalase and superoxide dismutase were evaluated by Real-time qPCR. In this way as beta-actin gene as housekeeping gene is used to normalize the data. The results indicate that the expression of antioxidant enzymes superoxide dismutase and catalase, included the highest level in the 5 treatments. Moreover, the expression of these genes showed a significant increase compared to the control in other treatments (treatments 2, 3 and 4). Therefore, the results indicated that the combination of extracts of wild pistachio and purslane can be together to be great impact on gene expression of antioxidant enzyme than the other groups under heat stress condition.

Broodiness, a maternal behavior and instinct for natural breeding in poultry, inhibits egg production. The turkey is one of the most important species having strong broody behavior and affects the poultry of its industry. Broody genetic and environmental factors influencing broodiness in poultry have been extensively studied, but the molecular regulation mechanism of broodiness is somewhat unclear. In this research, pituitary transcriptome of commercial turkey broiler from BUT breed was studied during the laying and broodiness phases. A total of 334 differentially expressed genes were identified. There were 229 upregulated and 104 downregulated at egg-laying phases compared with brooding phases. In the present study analysis of genes using KEGG software revealed that the genes in the Protein processing in endoplasmic reticulum pathway (P <0.05) are critical for controlling broodiness in the turkeys. Gene network analysis revealed that CANX, HSPA8, P4HB, HSPBP1 and ATF4 may act as important modulators of hormonal and behavioral mechanism associated with broodiness.

In the era of technological promotion, considering technological approaches in education is a necessity, not a choice. The importance of paying attention to such approaches in universities of medical sciences is more obvious, because new information replaces previous ones constantly and if universities wish to transfer this information in the shortest time, there is a need for modern teaching methods, as traditional methods do not account for the transmission of such large volume of information. The purpose of this study was to investigate the barriers of developing virtual education in Urmia University of Medical Sciences from the viewpoint of faculty members.

The statistical population of this research consisted of all the faculty members of Urmia University of Medical Sciences in 2017, from which 137 subjects were selected randomly. The data collection tool was a questionnaire whose validity was confirmed by experts and its reliability by Cronbachchr('39')s alpha (89%). The Data was analyzed using SPSS software version 19.

The results showed that the cumulative percentage of variance for the eight factors was 62/575 percent, which prevented technical support with 9/720 percent of the major share of the variance percentage, and cultural barrier with 3/315 percent of the lowest share of the percentage of variance Allocated.

According to faculty members, technical support was considered the most important barrier so with the increasing speed of the Internet, new systems must be replaced for disabled ones and through strengthening technological infrastructures, hindering factors for application of virtual learning is reduced.

Gonadotropin-releasing hormone (GnRH) is a key regulatory molecule of the hypothalamus–pituitary gonadal axis which induces transcription of luteinizing hormone (LH) from the anterior pituitary. Research has shown that estrogen plays an important role in regulating GnRH. Also, recent experiments indicated that Vitex agnus-castus (VAC) has high levels of phytoestrogen. Hence, this research was performed to investigate the effect of Vitex Agnuse Castus (VAC) fruit powder on GnRH and LH genes expression in laying hens using Real time qPCR technique. For this purpose, 90 Hy-line W-36 leghorn (at 72 to 80 weeks old) were used in a completely randomized design with 3 treatments, 5 replicates and 6 hens per replicate for 56 days as an experimental period. The three experimental treatments were: 1- control diet (basal diet without any additives), 2- basal diet plus 1% VAC fruit powder, 3- Basal diet plus 2% VAC fruit powder. At the end of the experiment one hens were slaughtered and their hypothalamus was rapidly separated and transferred to the laboratory with liquid nitrogen. Then, RNA was extracted and used for cDNA synthesis. Finally, GnRH gene expression was evaluated by Real-Time qPCR. The ANOVA results showed that GnRH gene expression was significantly increased in treatment 3 (diet containing 2% VAC) compared to the control and 1% VAC groups (P <0.01). While, addition of 1% VAC fruit powder to diet had no significant effect on GnRH gene expression (P> 0.05). Furthermore, addition of 1 or 2 % VOC fruit powder had no significant effect on LH gene expression (P> 0.05). The results of this study showed that the addition of VOC fruit powder fruit powder up to 2% level could not affect the pituitary-hypothalamic axis of laying hens at 72 to 80 weeks old.

Goats are highly adapted domesticated species and are considered as genetic resources for human beings around the world. Protecting and identifying genetic diversity in goat populations is imperative because of the risk of a severe decline. The Adani dairy goat is one of the most important indigenous goat breeds of Iran and is reared in the coastal area of the Persian Gulf in Boushehr province. In spite of high temperatures, humidity and low quality and quantity pastures, the breed has been well adapted to the harsh environmental conditions. Considering the importance of conservation of indigenous breeds adapted to harsh environmental conditions, the objective of the current study was to determine the maternal line and the phylogenetic relationship Adani goat breed using hyper variable region 1 (HVR 1). For this purpose, blood samples were collected from 12 Adani goats of Bushehr province. After DNA extraction, a 968 base pair fragment was amplified by specific primers using the PCR method and sequenced. Analysis of HVR1 sequences showed 10 haplotypes with 42 different positions. Moreover, the haplotype and nucleotide diversity based on HVR1 region were estimated 0.954 and 0.0123, respectively. These results indicate high genetic variation in Adani goat. The phylogenetic tree pattern revealed that the Adani goat was clustered with Afar breed from Ethiopia and also, was classified into haplogroup A. This could be due to the geographical location of Bushehr province and its location next to the Persian Gulf and the Sea of Oman.

This research was conducted to investigate the effect of different levels of protein (20 and 24%) and the replacement of methionine DL with L methionine on the expression of myogenic genes (atrogin-1 and MYF-5) using the RT-qPCR technique in Japanese quail. This experiment was done in the form of a 2×2 factorial with 4 treatments and 4 repetitions and 15 quail in each replicate. The first treatment included DL-methionine and 20% protein (control group). The second treatment consisted of L methionine and 24% proteins, and the third treatment included L methionine and protein 20% and the fourth treatment included DL-methionine and protein 24%. After 35 days of feeding and keeping the quails, with 8 hours interval of hunger, 2 quails were slaughtered in each replicate, and a piece of their chest has been removed immediately and was transferred to the laboratory with Liquid nitrogen, and froze in -80°c. After extraction of the whole RNA, its quality was measured and was used to generate and synthesis the cDNA. Eventually, the expression of myogenic genes was measured by the real-time PCR method. In this method, 𝜷-actin gene, as the source gene, was used to normalize the data. The results showed that by decreasing the protein level from 24% to 20%, atrogin-1 gene expression increased and the MYF-5 gene expression decreased. Also, the replacement of methionine DL with L-methionine did not have a significant effect on the expression of myogenic genes. The results indicated that DL-methionine could be replaced with L methionine, and a 24% protein level is more suitable than 20% in the Japanese quail diet.

In the present study, blood samples were collected from 97 Adani goat from Bushehr province in order to identify the polymorphism in the exon II region of MHC-DRB1 gene (Major Histocompatibility Complex) and also, its association with growth traits (birth weight and 3 months weight). Genomic DNA was extracted from blood samples. A 279-bp fragment was amplified using polymerase chain reaction (PCR). Eventually, the PCR products were digested by RasI enzyme. The results showed that there were 4 types of alleles A, B, C and D in this locus with the frequencies of %51, %26.8, %13.4 and %8.8, respectively. Five genotypes including AA, AB, BB, AC and AD were identified with the frequency of %14.432, %28.866, %12.371, %26.80 and %17.525, respectively. The results indicated polymorphism and high heterozygosity in the population under study. Also, the number of effective alleles, Shannon index, expected and observed heterozygosity for this site was calculated at 2.794, 1.179, 0.642 and 0.732, respectively. Moreover, the chi-square (χ2) test showed that population was not in Hardy-Weinberg equilibrium. The ANOVA results showed that the effect of different genotypes on birth weight was significant (p<0.05), but it was not significant on 3 MW (p<0.05). Furthermore, other traits such as dam age, sex, season and birth type effects were not significant on the growth traits (p<0.05). The highest birth weight was found for heterozygous AC and AD genotypes (3.05 and 3.02 Kg, respectively), and the lowest birth weight was related to pure AA genotype (1.75 Kg). It seems that selecting AC and AD genotypes can be expected to increase birth weight in Adani goat. Also, we expect that this gene can act as a candidate gene for genetic improvement of some growth traits in goat breeding programs.