m. t. beigi nassiri

The sex of chickens considerably impacts production performance and economic benefits in poultry farming. Male birds cannot lay eggs and usually have a lower ratio of meat to feed than broilers. Male chicks are typically killed immediately after hatching since they are redundant in the industry and male chicks will neither be suitable for egg production nor meat production. Day-old male chicks in the laying hen industry are usually culled immediately after hatching. As a result, this issue has caused moral concerns in societies. Efforts are underway to develop technology for automatically determining the sex of chick embryos, aimed at establishing a stable and efficient poultry farming system. In large commercial hatcheries, the sexing of newly born chicks is generally accomplished by three different methods according to new hatching lines' vent, color, or feathers. However, these methods are still time- and labor-consuming. If sex can be identified at an early embryonic stage or even before incubation, male eggs could be used as feed components. Moreover, fewer eggs would need to be incubated, which would reduce feed space requirements, CO2 emissions, and energy consumption, which are all economically beneficial to farmers and the environment. In recent decades, researchers have used various in ovo sexing strategies in chicken eggs before hatching or incubation. Some invasive and noninvasive studies that have been conducted for in ovo sexing of chicken eggs can be divided into five major categories: (i) molecular-based techniques, (ii) spectral-based techniques (Raman spectroscopy, fluorescent, 3D X-ray), (iii) acoustic-based techniques, (iv) morphology-based techniques, and (v) volatile organic compound (VOC)-based techniques. Commercially applicable methods must be noninvasive, rapid enough for real-time applications, economically feasible, and ethically acceptable. An alternative method, to prevent the removal of day-old chicks, is a non-invasive method to determine the sex of the egg in the early stages of hatching before the development of the nervous system. Recently, Raman spectroscopy was reported to determine the sex of eggs at the incubation stage. Raman spectroscopy is based on the Raman effect, whereby when incident light (wavelength 750–850 nm) excites molecules in a tissue, the molecules reflect light at a different wavelength. The reflected light's wavelength is characteristic of various chemical components and allows the detection of the atheromatous plaque chemical synthesis. Raman spectroscopy is a powerful tool expected to revolutionize chick sex determination because it can provide information about biological molecules. Thus, Raman spectroscopy is suitable for analyzing living organisms, leading to its widespread adoption across various biological and medical applications. Therefore, resonance Raman spectroscopies have found application in blood analysis, with some studies exploring its utility in chick sexing. For this purpose, the present study was carried out to investigate the feasibility of determining the sex of Iranian native chicken embryos using the Raman spectroscopy. To carry out this research, 100 fertilized eggs of Iranian native chickens were used. The sex of the embryos was determined using Raman spectroscopy with a wavelength of 785 nm during the fourth day of incubation. Validation of this method was investigated using the polymerase chain reaction (PCR) technique. Sequence alignment of CHD-Z and CHD-W allele sequences amplified by PCR technique. The amplified DNA fragments were single and double DNA bands in the size of 461 bp for the CHD-Z and 322 bp for the CHD-W genes. The PCR was carried out using a PCR master kit with specific primers (the forward primer: 5′- TATCGTCAGTTTCCTTTTCAGGT -3′, the reverse primer: 5′- CCTTTTATTGATCCATCAAGCCT -3′). Thermal cycling conditions for DNA amplification were: 1 cycle of initial denaturation at 94°C for 5 minutes; 35 cycles comprising 30s at 94°C for the denaturation, 30s at 59°C for annealing, 30s at 72°C for the elongation; and a final extension cycle at 72°C for 5 minutes. The PCR products were analyzed by electrophoresis on 2.5% agarose gel against a DNA Ladder 100bp, and visualized using the safe staining on UV transilluminator. The data obtained from the Raman spectrometer was analyzed using the Origin software. The main indices used to study the data were the intensity of the Raman peaks and the ratio of the dominant peak intensity. Additionally, principal component analysis (PCA) was employed to identify any patterns in the data. To calculate PCA1 and PC2, the ratios of I769/I838 and I1141/I1251 peaks were considered, respectively. PCA analysis can choose features that have a greater impact on the final result, depending on the data and the scope of their changes. The result of PCR showed that one fragment with a length of 461 bp was amplified for male embryos (ZZ) and two fragments with lengths of 461 and 322 bp were amplified for female embryos (ZW(. The study found that there are differences in the intensity of Raman bands between genders. Males have higher intensity while females have lower intensity. Therefore, changes in Raman spectra intensity can be used to identify gender. Additionally, the candlestick chart of the data showed that median and average values for males were larger than for females. Furthermore, the results obtained from PCA analysis showed that the variance percentages for PC1 and PC2 were 53.69% and 46.31%, respectively. PC2 is more reliable as it has less deviation. Based on the results obtained from the study, it can be concluded that Raman spectroscopy is a reliable method for determining the gender of chicken embryos during incubation. This test is quick, accurate, and can be easily incorporated into the industry to determine the gender of embryos without resorting to the practice of killing day-old chicks. Not only is this method more ethical, but it also offers a high level of accuracy, making it an attractive alternative for the industry. In general, these results demonstrate the potential application of hematological traits in developing an automatic in ovo embryo sexing method through spectroscopic analysis.

The DMB2 gene is one of the MHC cluster genes that plays a role in the humoral immune response. This study was performed to identify the polymorphism of exon 2 of the MHC-DMB2 gene and its association with the humoral immune response in Japanese quail. For this purpose, on day 28, 0.2 mL of 5% saline suspension of sheep red blood cell (SRBC) was injected into 130 quail's breast muscle (65 males and 65 females). Seven days later, cervical vein blood sampling was performed on the 35th day. Afterward, the anti-SRBC titer antibody was determined using a micro hemagglutination technique. Also, genomic DNA was extracted from blood samples and a 333bp fragment of exon 2 was amplified using polymerase chain reaction and PCR products were digested by Hinf 1 restriction enzyme. The results showed that there were two types of C (333bp) and G (226, 107bp) alleles in this region with a frequency of 74.6% and 26.4% in the whole population, respectively. The results indicate high polymorphism and high homozygosity in the studied population. In addition, the results showed that genotype had a significant effect on antibody titers (P<0.01). The CC genotype showed the highest total antibody titer (2.13 mg/dL) and the GG genotype showed the lowest total antibody titer (0.33 mg/dL). It is suggested that the negative effects of this single nucleotide polymorphism be considered in breeding programs.

This study was designed to investigate the use of different levels of soybean lecithin in the Tris extender on semen quality and sex ratio using real-time qPCR technique.

Sampling of 4 Holstien bulls was performed once a week, then the appropriate samples were mixed. Samples of sperm (in 4 replications) were divided into three groups: zero, one and two percentage soybean lecithin. The qualitative parameters and the sex ratio of the semen were determined. Swim up technique was used to wash the semen and remove the dead cells. Moreover, the PLP and SRY genes were propagated to separate the specific fragments of X- and Y- chromosomes sequences. In this procedure, PAR was used as a housekeeping gene to normalize the gene expression data in real-time qPCR.

The results showed that swim up technique and different levels of soybean lecithin improve the semen quality. In addition, swim up technique significantly reduced PLP gene expression (0.75±0.11), against increased SRY gene expression (1.37±0.13). However, using of different levels of soybean lecithin did not change the sex ratio of the sperms.

In general, soybean lecithin is an appropriate substitute to animal sources and improves the quality of semen. Due to the limitations of using animal resources in bull extenders, the use of soybean lecithin as a plant source is suggested.

Keratinases is the proteolytic enzymes in the nature. This enzyme is produced only in the presence of keratin substrate. That targets the disulfide bonds. In this study, keratinases gene was extracted from the bacterial strain Bacillus licheniformis was previously isolated from poultry litter. Amplification reaction was performed using DNA extracted from native bacteria as the template. After purification, keratinases gene was cloned in pTZ57R/T vector. After ligation, ker-pTZ57R/T construct was transferred into susceptible E. coli bacteria strain DH5α. PCR reactions using primers FB1 and RB1 on ker-pTZ57R/T construct, leading to gene amplification keratinases 1164 bp length with cut site XhoI and NcoI restriction enzymes for the transfer into appropriate expression pET-26b() vector. The recombinant plasmid, ker-pET-26b(), was extracted from positive colonies on LB agar with kanamycin antibiotic and was transferred into E. coli strain BL21. Keratinases cloned gene was sequenced. In the analysis of bioinformatics, molecular weight protein sequence of the nucleotide sequence was estimated at ~ 40 kDa. Protein net charge equal to -0.009 with aliphatic ratio is 84/73 and has the signal peptide. This enzyme is a serine protease with active sites aspartic acid 137, amino acid histidine 168 and serine 325. In general, the results of this bioinformatics studies indicated that the keratinase enzyme is considered to be a category of endogenous enzymes that can be used in various industries.

This study was designed to estimate the economic values for important economic traits of Lori goat in Lorestan. Finally the breeding objectives of this animal were determined. Phenotypic and production data for the study were collected from 6 flocks of goats raised under Lori goat breeding project. The questionnaire was designed and the goat rancher breeders were interviewed too. Statistics on revenues and costs were calculated based on the prices of years 2010-2011, according to mentioned questionnaires. Four traits including litter size, birth survival rates, replacement rates and the amount of milk in a lactation period were examined in this study. Also four growth traits including birth weight, weaning weight, daily growth from weaning to 6 months, and 6 months weight for kids were estimated in this research. A biological-economic model as an overall model and sub models for each of the above traits were designed. The corresponding coefficients for traits were estimated. Finally the production system was also analyzed. Based on this study the relative economic weights for litter size, survival rates, replacement rates and the amount of milk yield measured in two systems (one birth in year and 3 births in two years) were 361.89, 487.37, -1.38, 1, and 591.88, 799.75, -1.03 and 1 respectively. The relative economic weights for birth weight, weaning weight, daily growth from weaning to 6 months and 6 months weight in two mentioned systems were 4.96, 11.92, 92.28, 9.25 and 4.07, 18.97, 157.69 and 15.81 respectively. As a conclusion, the reproductive traits and growth rate have the highest economic coefficient, hence shoul be considered in Lori goat breeding programs under rural system.