polymerase chain reaction

The sex of chickens considerably impacts production performance and economic benefits in poultry farming. Male birds cannot lay eggs and usually have a lower ratio of meat to feed than broilers. Male chicks are typically killed immediately after hatching since they are redundant in the industry and male chicks will neither be suitable for egg production nor meat production. Day-old male chicks in the laying hen industry are usually culled immediately after hatching. As a result, this issue has caused moral concerns in societies. Efforts are underway to develop technology for automatically determining the sex of chick embryos, aimed at establishing a stable and efficient poultry farming system. In large commercial hatcheries, the sexing of newly born chicks is generally accomplished by three different methods according to new hatching lines' vent, color, or feathers. However, these methods are still time- and labor-consuming. If sex can be identified at an early embryonic stage or even before incubation, male eggs could be used as feed components. Moreover, fewer eggs would need to be incubated, which would reduce feed space requirements, CO2 emissions, and energy consumption, which are all economically beneficial to farmers and the environment. In recent decades, researchers have used various in ovo sexing strategies in chicken eggs before hatching or incubation. Some invasive and noninvasive studies that have been conducted for in ovo sexing of chicken eggs can be divided into five major categories: (i) molecular-based techniques, (ii) spectral-based techniques (Raman spectroscopy, fluorescent, 3D X-ray), (iii) acoustic-based techniques, (iv) morphology-based techniques, and (v) volatile organic compound (VOC)-based techniques. Commercially applicable methods must be noninvasive, rapid enough for real-time applications, economically feasible, and ethically acceptable. An alternative method, to prevent the removal of day-old chicks, is a non-invasive method to determine the sex of the egg in the early stages of hatching before the development of the nervous system. Recently, Raman spectroscopy was reported to determine the sex of eggs at the incubation stage. Raman spectroscopy is based on the Raman effect, whereby when incident light (wavelength 750–850 nm) excites molecules in a tissue, the molecules reflect light at a different wavelength. The reflected light's wavelength is characteristic of various chemical components and allows the detection of the atheromatous plaque chemical synthesis. Raman spectroscopy is a powerful tool expected to revolutionize chick sex determination because it can provide information about biological molecules. Thus, Raman spectroscopy is suitable for analyzing living organisms, leading to its widespread adoption across various biological and medical applications. Therefore, resonance Raman spectroscopies have found application in blood analysis, with some studies exploring its utility in chick sexing. For this purpose, the present study was carried out to investigate the feasibility of determining the sex of Iranian native chicken embryos using the Raman spectroscopy. To carry out this research, 100 fertilized eggs of Iranian native chickens were used. The sex of the embryos was determined using Raman spectroscopy with a wavelength of 785 nm during the fourth day of incubation. Validation of this method was investigated using the polymerase chain reaction (PCR) technique. Sequence alignment of CHD-Z and CHD-W allele sequences amplified by PCR technique. The amplified DNA fragments were single and double DNA bands in the size of 461 bp for the CHD-Z and 322 bp for the CHD-W genes. The PCR was carried out using a PCR master kit with specific primers (the forward primer: 5′- TATCGTCAGTTTCCTTTTCAGGT -3′, the reverse primer: 5′- CCTTTTATTGATCCATCAAGCCT -3′). Thermal cycling conditions for DNA amplification were: 1 cycle of initial denaturation at 94°C for 5 minutes; 35 cycles comprising 30s at 94°C for the denaturation, 30s at 59°C for annealing, 30s at 72°C for the elongation; and a final extension cycle at 72°C for 5 minutes. The PCR products were analyzed by electrophoresis on 2.5% agarose gel against a DNA Ladder 100bp, and visualized using the safe staining on UV transilluminator. The data obtained from the Raman spectrometer was analyzed using the Origin software. The main indices used to study the data were the intensity of the Raman peaks and the ratio of the dominant peak intensity. Additionally, principal component analysis (PCA) was employed to identify any patterns in the data. To calculate PCA1 and PC2, the ratios of I769/I838 and I1141/I1251 peaks were considered, respectively. PCA analysis can choose features that have a greater impact on the final result, depending on the data and the scope of their changes. The result of PCR showed that one fragment with a length of 461 bp was amplified for male embryos (ZZ) and two fragments with lengths of 461 and 322 bp were amplified for female embryos (ZW(. The study found that there are differences in the intensity of Raman bands between genders. Males have higher intensity while females have lower intensity. Therefore, changes in Raman spectra intensity can be used to identify gender. Additionally, the candlestick chart of the data showed that median and average values for males were larger than for females. Furthermore, the results obtained from PCA analysis showed that the variance percentages for PC1 and PC2 were 53.69% and 46.31%, respectively. PC2 is more reliable as it has less deviation. Based on the results obtained from the study, it can be concluded that Raman spectroscopy is a reliable method for determining the gender of chicken embryos during incubation. This test is quick, accurate, and can be easily incorporated into the industry to determine the gender of embryos without resorting to the practice of killing day-old chicks. Not only is this method more ethical, but it also offers a high level of accuracy, making it an attractive alternative for the industry. In general, these results demonstrate the potential application of hematological traits in developing an automatic in ovo embryo sexing method through spectroscopic analysis.

Aflatoxins are a large group of mycotoxins that are produced through Polyketide pathway by specific species of Aspergillus flavus</em>, Aspergillus parasiticus,</em> and  Aspergillus nomius</em>. These pesticides are known to be the most dangerous mycotoxins affecting human and livestock health (Pleadin et al. 2014). Several hundred mycotoxins have been identified, and more than 25% of the world annual grain production is contaminated with mycotoxin (Smith et al. 2016). Among the 400 known mycotoxins, Aflatoxin B1, B2, G1, and G2 are the most important food and feed mycotoxins (Costanzo et al. 2015). Aflatoxin M1 and M2 are the hydroxyl metabolite of aflatoxin B1 and B2 that can be found in milk or other animal products (Hussein and Brasel. 2001). At the first level, the main manifestations of mycotoxins exposure in animals are reductions in feed intake and weight gain. At the second level, mycotoxins affect the quantity of animal products. The third level of influence is the safety and quality of the products from exposed animals (Wang et al. 2019). The present study was designed to detect contamination of aflatoxin M1 in milkand, aflatoxin B1 in feed and subsequent molecular isolation and identification of Aspergillus flavus</em> species.

In this study, 10 milk samples from milk reservoirs and 10 feed samples from a total mixed ration of livestock from dairy farms of East Azarbaijan province (Tabriz and Marand) were collected. After preparation of samples, the experiment was conducted using competitive ELISA method. The principles were as follows: after adding standard solutions or samples to the wells, aflatoxin M1 was bonded from specimens or standards to specific antibody binding sites. After 30 minutes of  incubation step, unbound reagents were removed during a single wash step. Horseradish peroxidase (HRP) aflatoxin M1 was added to the wells and after one 15 minutes of incubation, the unlinked conjugate was removed during the washing step. Then, some aflatoxin M1-HRP was coherent by adding a substrate/chromogen (H2</sub>O2</sub>/TMB) solution. In the presence of colorless chromogen, mixed conjugated aflatoxin and M1-HRP agent was converted to colored product. The addition of sulfuric acid caused the suspension of the substrate reaction and finally, the light intensity was measured by a photometric method at 450 nm. Optical density had an inverse relationship with the concentration of aflatoxin in the sample. To isolate the fungus, first 2 g of the standardized feed  were weighed and milled  in  a falcon containing 18 ml of physiological serum and then, mixed well with a vortex for five minutes. A portion of the diluted feed was removed and cultured on plots containing a Potato Dextrose Agar medium at several locations. Plates were incubated for 7 days at 25 ℃. DNA was extracted from Potato Dextrose Broth (PDB) medium. The resulting mycelium mass was frozen and converted to a uniform powder by liquid nitrogen. DNA extraction was carried out by placing the samples in a buffer and purification with organic solvents such as chloroform/isoamyl alcohol and finally, curing with cold isopropanol. The resulting DNA was stored at -20 ° C. In order to evaluate the actuary of identification for Aspergillus flavus, </em>the primer sequence of AFLA-F and AFLA-R gene was aligned using the BLAST software (GenBank) to find similarity rate within resisted reference sequences. Each PCR reaction consists of: 6 μl of PCR Master Mix, 2 μl extracted DNA, 0.2 μl of each recipe primer, 1.6 μl of distilled water. Then, 10 μl of the final volume of reaction was placed on thermosecler device. A PCR program for amplification of the targeted PCR fragment was fixed based on following temperature: Initial denaturant at 95℃ for 10 min, {denaturant at 95℃ for 1 min, annealing at 66℃ for 2 min, extension at 72℃ for 2 min (total 34 cycle)} and the final amplification at 72℃ for 5 minutes (Zachová et al. </em>2003). Isolated strains of Aspergillus</em> strains were verified using the PCR method; its reaction products were detected in 1% agarose gel by electrophoresis.

The results showed that all milk and feed samples were contaminated with aflatoxin, but the contamination rate of milk samples was lower than the standard values of Iran, America, and the European Union (0.1, 0.5 and 0.05 μg / Kg). Among the 10 collected samples, only two edible samples with aflatoxin B1 contamination were higher than the Iranian and European standards (5 μg / kg). The contamination level of milk and feed samples were observed in the range of 0.021-0.05 and 1.1-6.9 μg / kg, respectively. Statistically, there was a significant difference between the mean of contamination of aflatoxin M1  in milk and B1 in feed in the region with national and international standards and the mean of M1 and B1 contamination was lower than these standards. The level of aflatoxin M1 in milk was detected by HPLC method, indicating that the infection rate of 10 samples was 0.02-0.31 μg / l (Besufekad et al. 2018). In another study, 178 wheat samples were collected in China and reported 18.8% of the samples contaminated with aflatoxin B1 (Liu et al. 2016). The results of the fungal species also showed that the analyzed samples did not show any bands in the 413bp range. As a result, it can be said that the dominant species and the main cause of contamination were not Flavus</em> species. Wang et al. (2016) reported that aflatoxins are mainly produced by the genus Aspergillus</em>, and are commonly found in food and feed in humid and warm environments. Research results in India show that among the 15 collected samples, only 9 samples (60%) were infected with Aspergillus</em>. Seven samples were detected as  Aspergillus flavus</em> and two samples as  Aspergillus niger</em> (Khare et al. 2018).

 Milk composition, body mass gain, immunity, and reproductive performance are affected in dairy ruminants by feeds contaminated with aflatoxins. It is expected that by controlling animal feed agaisnt aflatoxin and reducing its levels in feed by improving production and storage conditions, a suitable method for preventing contamination of milk and its products will be adopted to help improve the health of the community.

This study was conducted to investigate association between prolactin gene polymorphism and milk yield of Shirvan Kurdi sheep. Prolactin is a lactogenic hormone that plays a significant role in milk production; its depletion in sheep provokes a severe reduction of milk secretion suggesting that prolactin is a functional candidate gene that could contribute to variations in milk yield. An Investigation indicated that polymorphism prolactin gene in Chios sheep. They identified a 23-bp indel (insertion or deletion) in the 213 region and found that the B allele is the result of a 23-bp deletion in a allele. They also reported A and B allele with the frequencies of 0.71 and 0.29, respectively and foundthat the B allele may be associated with higher milk yield. The present study investigated the association between polymorphisms in prolactin gene and daily milk yield records of Kurdi ewes in Hossien Abad Kurdi sheep breeding station.
In this study, blood samples were collected randomly from 100 milking Kurdi ewes in Hossien Abad Kurdi sheep breeding station. Milking was carried out by hand combined with lamb suckling at 14 days intervals starting from May to Agust 2012.Allele and genotype frequencies, chi-square test and the goodness of fit test for Hardy–Weinberg equilibrium were calculated with PopGeneV 1.31 software. Statistical Analysis was performed using INBREED and the MIXED procedures of SAS to estimate the association of genotypes with milk production.
A 23-bp indel (insertion or deletion) was identified in prolactin gene by PCR.A mixed model was used to investigate the association of prolactin gene with test day milk yield. AA genotype had the highest genotype frequency in the studied population (0.60).A and B allele frequencies were 0.765 and 0.235, respectively. Results indicated that there was no significant association between prolactin gene polymorphism and milk yield in the studied population.
In the present study, no genotype was identified to be better than the others and there was no significant association between prolactin gene polymorphism and milk yield.

The objective of this study was to detect mutation in intron 1 of myostatin gene using 110 individuals of Lori sheep breed. A 414-bp fragment of myostatin gene intron 1 was amplified and evaluated using PCR-SSCP. Five different SSCP patterns (genotype) and five alleles were observed. Frequencies of alleles A, D, C, E and F were 0.69, 0.19, 0.07, 0.02 and 0.03, respectively. Frequencies of genotype AA, AD, AC, AE and AF were 0.38, 0.36, 0.15, 0.05 and 0.06, respectively. Heterozygosity value was found to be 0.61. The chi-square test showed that the population has been deviated from Hardy- Weinberg equilibrium for the locus studied (P<0.05).