فصلنامه پژوهشهای علوم دامی ایران
سال نهم شماره 2 (تابستان 1396)

The main protein degradation product in ruminant is urea. The urea synthesized in liver and lost to the environment via urine and feces. However, there is mechanism in ruminants to recycling 40 to 80% of hepatic urea-N output to the gastrointestinal track (GIT). During the process of urea nitrogen salvaging (UNS), urea entry into the ruminant gastrointestinal tract via facilitative urea transporters. The passage of urea across cell membranes is facilitated by such transporters then the urea descends a concentration gradient and derived from two separate genes: SLC14A1 (UT-B) and SLC14A2 (UT-A). There is a chance for controlling of urea-N recycling to the GIT, via manipulating the dietary factors such as level and type of dietary crude protein that affect urea transporters-B expression. However changes in urea transporter expression in the rumen tissue of ruminants in response to dietary changes have not fully understood. Hence our hypothesis was that changes in the type of dietary protein sources and the level of dietary crude protein, are important because they determine how much N is directed toward ruminal NH3-N (25). This study aimed to show how concurrent alters in dietary protein sources and crude protein change nitrogen efficiency and ruminal UT-B expression in Baluchi male lambs.
Four Baluchi male lambs (30 ± 2 kg BW) were used in a 4 × 4 Latin square design with 28-d periods (adaptation: 21 d and sampling: 7 d) and a 2 × 2 factorial arrangement of dietary treatments. Lambs had free access to clean water over the experimental period. The dietary factors studied were: 1) canola meal vs. canola meal with fish meal as the principal source of protein; and 2) dietary levels of crude protein of 16 vs. 18%. Treatments were offered to the animals twice daily for ad libitum intake (09:00 and 16:00 h). The DM, OM, and N contents were determined according to the AOAC. Volatile fatty acids were separated and quantified by gas chromatography. Ruminal NH3-N was determined using distillation method. Total N in pooled urine was determined using the macro-Kjeldahl procedure. For UT-B gene expression analysis, total RNA was extracted via High Pure RNA Isolation Kit, followed by digestion with RNasefree DNase. About, 1 µg of RNA was used to generate first-strand cDNA using cDNA Synthesis Kits. Gene transcript abundance was quantified using real-time quantitative PCR using SYBR Green fluorescence detection. The primers used for urea transporter-B (UT-B) and ovine glyceraldehyde 3-phosphate dehydrogenase (ovine GAPDH; NCBI Accession No. BC102589) were previously reported. Ovine GAPDH was used as an internal reference to normalize UT-B mRNA expression. Briefly, the PCR primers were UT-B (forward, 5′/ggacctgcctgtcttcactc/3′; reverse, 5′/gatcaaggtgcttgggaaaa/3′) and ovine GAPDH (forward, 5′/gattgtcagcaatgcctcct/3′; reverse, 5′/ggtcataagtccctccacga/3′) with amplicon size of 97 and 94 bp, respectively. Amplification conditions for ovine GAPDH and UT-B included a predwell for 3 min at 95 °C and 35 cycles of denaturing for 30 s at 95 °C and annealing for 30 s at 58 °C. The real-time qPCR reaction mixture used for each gene consisted of 12.5 μL of Maxima SYBR Green qPCR Master Mixes, 0.5 μL of each primer (25 μM), and 1.0 μL of template cDNA, made up to 25 μL. The amplification efficiency was 100.1%.
Result and Disscusion: Lambs fed CM have greater nutrients intake, significantly. Crude protein level had no significant effect on nutrients intake except CP intake. Nutrients digestibility was not affected by treatments, CP content and dietary protein sources. Ruminal pH, VFA concentration and acetate to propionate ratio were not influenced by the experimental diets and dietary protein sources. Significant differences were observed for NH3-N and BUN concentration in lambs fed treatments contain 18% CP compared to the lambs fed diets contain 16% CP. Both of CP content and dietary protein sources had significant effect on N intake and urinary N excretion. Nitrogen intake and urinary N excretion increased as dietary CP level increased. Lambs fed CM have greater N intake and urinary N excretion, significantly. Fecal N excretion was not affected by treatments, CP content and dietary protein sources. Lambs received CM diets had higher apparent N balance. Expression of urea transporter-B mRNA (expressed as copies/copy of ovine GAPDH) was not affected by treatments. Also, dietary CP content and dietary protein sources could not impact on the expression of UT-B mRNA.
Our finding suggest in studing of manipulating the expression of UT-B mRNA, both dietary factors such as dietary crude protein level and type of protein sources and ruminal factors shch as intra and para cellular pH should be considered.

Subabul (leucaena leucocephala) is a multipurpose leguminous tree in the tropics and high-quality feed resource for ruminants especially during the dry season in most tropical and subtropical areas. Its leaf has high content of N (16 - 23 % crude protein) and Ca, a low content of tannins and phenolic compounds. The researchers reported dietary supplementation with leucaena silage could enhance feed intake, digestibility, and rumen fermentation in dairy steers. Therefore, this experiment was conducted to investigate the effect of subabul as a replacement for alfalfa on rumen fermentation and digestion, rumination and blood metabolites of Najdi goat. Materials and
The eight Najdi goats with average body weight average of 35 kg that were fed with the control diet and diet containing subabul (50 percent of alfalfa) for 40 days. Animals were randomly treated with four replications. Forage to concentrate ratio was 50 to 50. The leave of subabul were collected from Mollasani and milled. Diets fed twice per day for 40 days. Daily feed intake, nutrient digestibility, rumen and blood parameters and rumination activity was recorded. Rumen fluid was collected from animals before the morning feeding. About 200 mg sample (1.0 mm screen) incubated with 35 ml buffered rumen fluid under continuous CO2 reflux in 100 ml vials for 2, 4, 6, 8, 10, 12, 16, 24, 48, 72 and 96 h, in a water bath maintained at 39°C. Cumulative gas production data were fitted to the exponential equation Y=B (1−e−Ct). Partitioning factor, microbial biomass, actually degradable organic matter was calculated by Makkar. Digestibility of dry matter and NDF of the samples were determined. Data were subjected to analysis as a completely randomized design using the General Linear Model (GLM) procedure of SAS. Results and Discussion The results showed that the dry matter intake in goats fed with control treatment was more than treatment containing subabul (P Therefore, subabul as a substitute for 50 % of alfalfa had no negative effect on dry matter digestibility and fermentable parameters, so it can be used as a forage replacement in Najdi goat diet.

Peripartum heifer feeding and management can have a substantial effect on her health and profitability. Suboptimal transition from late gestation to early lactation diet can decrease milk production, lactation persistency, and reproduction performance. Many nutritional innovations for the transition cow have been developed and deployed within the dairy industry. In the most previous studies, dietary treatments were imposed during the prepartum period and then the cows were fed a common diet during the post-calving period. In our study, we focused on the interaction of pre- and early post-partum diet of heifers. The aim of this study was to know the interaction effects between the prepartum diet starch degradability and postpartum diet starch amount in iso- energetic diets.
Forty heifers (BW, 600 ± 80 kg; BCS, 3.5± 0.25) were used in a completely randomized design and assigned randomly in to a 1 of 2 dietary treatments (ground barley vs. corn grain) in pre-partum period (24 ± 3 d relative to expected calving until calving) and then the cows in each group were randomly assigned in to a 1 of 2 lactation diets with high or low starch amount from 1 to d of calving. Then all the cows received the same high energy lactation diet until d 270. All diets were offered as total mixed ration (TMR) with similar crude protein and energy (low energy diets) content. Blood samples were taken at −20, and d relative to calving. Data were separately analyzed for pre- and post-partum periods by Proc Mixed of SAS with diet and time as fixed effect and animal nested in diet as random effect.
There were no significant differences in milk production and content except milk lactose in heifers fed prepartum diets during 28 days after calving. The prepartum barley diet increased milk lactose content compared to corn diet (P The results of this study showed production and metabolic responses of fresh and lactating heifer to high or low starch diet depends on starch ferment ability in low energy prepartum diets. Heifers fed high or low fermentable starch diet in prepartm period had more smooth transition to high or low starch diet in postpartum period respectively. Transition from low fermentable starch diet to high starch diet can compromise milk production and health of heifers after calving.

The innovation of antibiotic growth promoters in poultry production has brought fundamental economic advantage. However, their long-time utilization leads to enhance manifestation of antibiotic-resistant bacteria. It becomes more and more difficult to deal with bacteria mediated infections. Therefore, alternatives to traditional antibiotic growth promoters, which can promote livestock performance without generating drug-resistance, are urgently needed. Medicinal herbs have potential to act as antibiotic growth promoters to alternatives due to their beneficial effects of antimicrobial actions. Recently, many materials have been innovated as a superseded to antibiotics such as probiotics, prebiotics and medicinal plants. Probiotics increase production performance by reducing the nutrients available for noxious bacteria and also reduce the production of toxic bacterial metabolites. Chicory plant due to its special characteristics and ingredients is used as an herbal medicine. All parts of this plant especially roots have medicinally important compounds. There are not many reports regarding to use chicory extract in broiler chickens. Therefore, this experiment was conducted in order to evaluate effect of different levels of chicory plant extract on performance, blood parameters, intestinal microflora and immune response of broiler chickens.
Material and In order to evaluate chicory extract and probiotics on performance, carcass characteristics and blood parameters, a completely randomized design with five treatments and three replicates was carried out with 180 Ross 308 male chickens in 42 days. The treatments included: 1- control diet; 2- control diet Virjiniomaysin antibiotic (150 mg/kg diet); 3- control diet 爘鲢 extract (3ml/L); 4- control diet ᦩ斊髨 probiotics (300 mg/kg diet) and 5- diet containing chicory extract and probiotics (3ml/L and 300 mg/kg diet). For preparing dietary treatments, a basal diet was formulated to meet or exceed the nutrient recommendations for broiler chickens according to NRC requirements. Feed and water provides as ad libitum for birds throughout the experiment. Body weight gain, feed intake, and feed conversion ratio were determined during the experiment. Birds were reared on litter floor pen and a continuous lighting program with 23 h light and 1 h darkness was used. At the end of experiment, after 8 h of fasting, two chickens from each replicate were selected for performance, carcass characteristics, blood parameters and intestinal microflora assay. Blood samples were collected from the brachial vein and plasma by centrifugation of the noncoagulated blood at 3000 × g for 10 min. The plasma samples were kept in the deep freezer until analysis for determining blood parameters. In order to assay immunity response at 28 and 35 days age, 0.1 ml sheep red blood cell was injected to two birds of each replicates and after seven days from injection 2 ml blood samples were taken form brachial vein.
Treatments did not have any significant effect on feed intake, body weight gain and feed conversion ratio (P>0.05). Carcass, breast, thigh, liver and bursa fabricius percentages, were not affected by treatments (P>0.05). The results showed a significant decrease in the abdominal fat of treatment 5 fed with chicory extract and probiotics. Chicory extract may provide direct functional support to digestive reactions in the body. First of all, chicory root increases the flow of bile, which supports digestion, because extra bile helps break down fats, therefore supplementation chicory extract to diet could lead to decreasing abdominal fat. Analysis of variance of data did not reveal any significant effect on blood glucose, triglycerides and VLDL concentrations. The lowest concentration of cholesterol and highest concentration of HDL were obtained in group 5 and control group. Whereas the decrease in blood HDL and cholesterol level might be due to the properties of chicory leaf extract to stimulate lactic acid producing bacteria secreting the hydrolase that in turn converts bile salts into de-conjugated bile acids and ultimately resulted in the reduced serum cholesterol level. Experimental treatments did not affect antibody titer (IgG¡ IgM), although IgG titers tend to reduce. Prebiotics act as an alternative treatment to antibiotics and chemicals, and play the role of alarm molecules to activate the immune system. Probiotic bacteria include the adherence capability, antagonism against pathogens and production of extracellular enzymes.
The results of this experiment suggested that adding combination of chicory extract and probiotics into broiler diets can reduced abdominal fat percentage and enhance immunity response.
Material and In order to evaluate of chicory extract and probiotic on performance, caracass characteristics and blood parameters a completely randomized design with five treatments and three replicates was carried out with 180 Ross 308 male chickens in grower periods. The treatments included 1: control diet; 2: control diet Virjiniomaysin antibiotic (150 mg/kg diet); 3: control diet 爘鲢 extract (3ml/L); 4: control diet ᦩ斊髨 probiotic (30O mg/kg diet) and 5: diet containing chicory extract and probiotic. For preparing dietary treatments, a basal diet was formulated to meet or exceed the nutrient recommendations for broiler chickens according to NRC requirements. Feed and water provides as ad libitum for birds throughout the experiment. Body weight gain, feed intake, and feed conversion ratio were determined during the experiment. Birds were reared on litter floor pen and a continuous lighting program with 23 h light and 1 h darkness was used. At the end of experiment, after 8 h of fasting, two male chickens from each replicate were selected for performance, Caracas characteristics, blood parameters and intestinal microflora assay. Blood samples were collected from the brachial vein and Serum was obtained by centrifugation of the coagulated blood at 3000 × g for 10 min. The sera samples kept in the deep freezer until analysis for determining blood parameters. In order to assay immunity response at 28 and 35 of age, 0.1 ml sheep red blood cell was injected to two birds of each replicates and after seven days from injection 2 ml blood samples were taken form brachial vein.
Effect of treatment didn’t significant effect on feed intake, body weight gain and feed conversion (P>0.05). Carcass, breast, thigh, liver and bursa fabricius percentages, were not affected by treatments (P>0.05).The results showed a significant decrease in the abdominal fat in birds of treatment group 5 that inclusion with chicory extract and probiotic. Chicory may provide direct functional support to the digestive reactions in the body. First of all, chicory root increases the flow of bile, which supports digestion. Because extra bile helps break down fats, therefore supplementation chicory extract to diet could lead to decreasing abdominal fat. Analysis of variance of data did not reveal any significant effect on blood glucose, triglycerides LDL and VLDL concentrations but HDL and cholesterol concentrations did affect with inclusion of treatments. Whereas the decrease in blood HDL and cholesterol level might be due to the properties of chicory leaf extract to stimulate lactic acid producing bacteria secreting the hydrolase that in turn converts bile salts into de-conjugated bile acids and ultimately resulted in the reduced serum cholesterol level. Immune response for SRBC were markedly enhanced by chicory extract plus probiotic treatment (group 5) as compared to other group. Prebiotics act as an alternative treatment to antibiotics and chemicals, and play the role of alarm molecules to activate the immune system. Probiotic bacteria include the adherence capability, antagonism against pathogens and production of extracellular enzymes
In conclusion, the results of this experiment suggested that adding combination of chicory extract and probiotics combined in broiler diets can reduced abdominal fat and enhance immunity response.

An experiment was conducted to investigate the comparative effect of Berberis voulgaris, symbiotic and virginiamycin (VM) on performance and immune response of broilers. Berberis vulgaris is a bush with yellow to brown coloured bark. The plant has obovate leaves, bearing pendulous yellow flowers in spring succeeded by oblong red coloured fruits. Berberine is the main active alkaloid with a benzyl tetra hydroxy quinoline chemical structure which can be found in all part of Berberis vulgaris especially in its fruit (barberry). berberine, a well known alkaloid, has marked antibacterial effects.
A total of 200 Ross 308 male broiler chickens, initially weighing an average of 43 g, were randomly assigned to 5 treatments, with 5 replicates/treatment (8 chickens/pen). The experiment was performed as randomized block design and the birds were fed either a corn–soybean meal basal diet (control) or the basal diet supplemented with 0.02% VM; 0.15% symbiotic and 1 and 2% of berberys powder (BV1 and BV2). The diets, in mash form, were offered ad libitum and the birds had free access to water. All birds were maintained under a lighting control system and uniform temperature during the period. The light regime was 23 h light/1 h darkness. The ambient temperature was gradually lowered from 33ºC to 22ºC on day 28 and was then kept constant. Bodyweight gain (BWG) and feed intake (FI) were measured at 10, 28 and 42 days of age. Feed conversion ratio (FCR) was calculated as feed intake divided by bodyweight gain. To assay the primary and secondary antibody responses against SRBC, at 28 and 35d of age, 2 birds/replicate were immunized intramuscularly with 0.5 mL 10% SRBC in. Blood samples (1.5 mL/bird) were obtained from the brachial vein at 7d following each injection (days 35 and 42 d). Two birds from each treatment were also selected at 42 days of age to evaluate the immune response by a cutaneous basophil hypersensitivity (CBH) test using phytohemaglutinin PHA-M (Invitrogen). Phytohemaglutinin at 100 μgr was intradermally injected between the third and fourth interdigital folds of each birds left foot. The same volume of saline solution was applied to the left foot as a negative control.
After 6 wk, the birds fed diets symbiotic had lowest feed consume than other group. Highest body weight was represented in the birds fed diets antibiotic and symbiotic respectively. Feed efficiency improved significantly in all treatment groups except for the BV1 diet. All diet decreased the heterophil level and the blood heterophil / lymphocyte ratio compared with the control group. The symbiotic diet increased lymphocyte level than the other group. Dietary treatments had no significant effect on the relative lymphoed organs weights. The broiler chickens fed the symbiotic and BV2 exhibited a significantly secondary antibody response against Gambaro and Newcastle vaccine as compared with the control group. The additives used in this study failed to have any significant impact on the anti-SRBC titers of total, IgM, and IgG antibodies and there was no interaction between treatment and time for interdigital reaction to phytohemaglutinin. The results of this study are supported by other studies that similarly reported a beneficial effect on body weight, feed efficiency due to dietary symbiotic. Symbiotic is defined as a mixture of probiotics and prebiotics that beneficially affects the host by activating the metabolism of one or a limited number of health promoting bacteria and/or by selectively stimulating their growth improving the host’s welfare. It seems that synergistic effects of prebiotics and probiotics can be useful in stimulating beneficial bacteria and improving the health of the gut. Chand et al, (2005) observed the beneficial influence of barberry seed on productive performance of broilers. The improvement of feed efficiency by spices and their derivatives may be attributed to the stimulation of gastric and pancreatic digestive enzymes and /or modulation of microbial population by phytogenetic products which leads to more absorption of nutrient. The differences in the efficiency between different batches of spice products can partly be explained by variations in bioactive components and yield, composition and activity of them. it can be concluded that the potential effect of active components from spices in broiler chickens may depend on the dosage used.
In conclusion, dietary Barberry powder at a level of 2% diet enhanced growth performance, improved resistance to stress and immune status which was comparable to that of VM used as an antibiotic growth promoter.

It has been estimated that feed is the major cost associated with commercial poultry production. Hence, inclusion of non-conventional feed resource becomes of primary importance in livestock production to maintain the productivity at a lower cost. Date palm fruit is one of the most important products of Middle East countries and its byproduct can help to lowering the feed cost in livestock nutrition.
There are a few studies about use of date palm byproduct in poultry nutrition and especially in laying hens diets, therefore, in this study, we considered the effect of different levels of date waste powder on laying hens performance.
Two independent experiments were conducted to determine the nutritional value of date waste powder (DWP) and its effects on performance and egg qualitative traits of laying hens. In the first experiment, AOAC method was used for determination of proximate analysis of DWP. In the second experiment, a total of 144 Hy-Line W-36 leghorn hens (at 46 wk old) were housed in cages and randomly allocated to 6 treatment groups for 6 weeks. Each group was divided in to 4 replicates. Feed and water were provided ad libitum. The hens received basal diet (corn and soy based diet with 15.00 % crude protein and 2820 kcal/ kg ME) that was formulated to meet the Hy-line W36 requirements recommended for nutrients. The diet did not have any antibiotics and coccidiostats. Treatments were included 0, 5, 10, 15, 20 and 25 percentage of date waste powder by expense of corn in basal diet. Experiment was designed in a completely randomized design. Egg weight (gr), egg production (%) and egg mass (gr/hen/day) were recorded daily. Feed consumption was measured weekly and feed conversion ratio (FCR) (grams of feed: grams of egg mass) was calculated weekly too. At the end of weeks 2, 4 and 6 of the experiment, two eggs from each replicate were randomly selected for measurement the egg qualitative traits.
The results of these experiments showed that gross energy (GE), crude protein (CP), ether extract (EE), crude fiber (CF), calcium and ash of DWP were 4663 (Kcal/Kg), 7.17 (%) 11.45 (%), 30.64 (%), 0.63 (%) and 2.06 (%) of dry matter, respectively. Feed intake, egg weight and feed conversion ratio of the laying hens were not affected by inclusion different levels of dietary DWP. Egg production and egg mass were highest in 25% of DWP inclusion. This result may be related to the high levels of vegetable oil in this diet to maintenance the energy level. Adding vegetable oil to the diet increase the palatability of the diet, reduce dust and improve food texture and consequently increased nutrient utilization. Dietary inclusion of 25% DWP significantly decreased haugh unit of eggs compared to the 5, 10 and 15% inclusion level. Low availability of amino acids in this level may reduce albumen height. Egg yolk color decreased significantly at 10 and 15 % DWP rather than control group and increased in higher levels of DWP. Plant oils contain carotenoids, which can increase yolk color. Therefore, based on the results of this experiment, it could be concluded that inclusion of DWP in 20 and 25% can improve egg production of laying hens, and economically, the cost spent for producing one Kg egg, when using high levels of DWP was comparable with conventional commercial diets.

Advances in high-throughput assays for genotyping single nucleotide polymorphisms (SNP) led to using these dense markers for predicting genomic breeding values, called genomic selection, and have been revolutionized both animal and crop breeding programs. The accuracy of genomic predictions is determined by the size of the reference population, extent of relationships between selection candidates and the reference population, linkage disequilibrium among markers and QTLs, the method used to estimate marker effects, and genetic architecture of the trait. Most of stuides on this topic focus on continuous traits, but some of economical important traits in livestock are threshold. Therefore, a stochastic simulation was used to compare 125 different scenarios for a threshold trait based on five 10, 50, 150, 500 and 2000 underlying QTL numbers, five normal, uniform, t, gamma and Laplace distributions for QTL effects and five BayesA, BayesB, BayesC, BayesL and BayesR methods for estimation of marker effects.
In order to compare the different methods, R software were used to simulate datasets. Simulation started with a base population of 100 animals, including 50 male and 50 female, which randomly mated for subsequent 50 generations. Generations were discrete and number of animals for each generation fixed at 100 animals. Thereafter, by randomly mating of animals in generation 50, reference population generation with 1000 animals were obtained and a threshold trait was simulated for each of them. Finally, Next validation population generation was produced by randomly mating of animals from the previous generation. Simulated genome for each animal consisted of 10 chromosomes with equal 1 Morgan lengths, each having 1000 evenly spaced SNPs. In each scenario QTLs were randomly distributed on genome and their substitution effects were drawn from one of five normal, uniform, t, gamma and Laplace distributions. Marker effects were estimated in reference population using five different Bayesian methods that differ with respect to assumptions regarding distribution of marker effects, including: Bayes A, Bayes B, Bayes C, Bayes L and Bayes R. These estimated markers effects were used for genomic breeding value predictions of animals in validation population which did not have any phenotype. The accuracy of the different methods was calculated as correlation between true and estimated genomic breeding values.
Results of this study showed that Bayes A, Bayes B and Bayes C predictions was affected by QTL numbers and distributions, while Bayes L and Bayes R had almost same accuracies for all scenarios. Scenario with gamma distribution for QTL effects and number of 10 QTLs had highest accuracy for Bayes A, Bayes B and Bayes C methods. Bayes C method was the best method when number of QTL was low. Increases in number of QTL from 10 to 150 were decreased accuracy of Bayes A, Bayes B and Bayes C methods and after that accuracy of different methods was constant and same. When distributions of QTL effects was uniform lower accuracy achieved rather than other distributions for same QTL number, instead distributions with unequal QTL variance like gamma increased accuracy of Bayes A, Bayes B, and Bayes C methods. These results were because of different extent of shrinkage of estimates of effects for different methods. Methods like Bayes B induced differential shrinkage of estimates relative to methods like Bayes R and Bayes L lead to higher accuracy for scenarios with low QTL number and unequal QTL variance.
Conclusion in a nutshell, different studied methods had diverse results for various QTL number and distribution, and its difficult to suggest a method that best in all situations. However, it is better to use methods like Bayes B when the number of QTLs was low and each QTL had not equal contribution to the trait of interest.

In compare with other dairy animal, the most important components of goat milk are protein and fat. Due to association between milk proteins and economic traits, there are a lot of studies about genetic structure of milk proteins. Nowadays, the effect of genetic polymorphisms in goats and other species and association with production traits and health widely was investigated. One of the most important topics for the genetic characterization of dairy breeds is investigation of the casein genes. The goat casein genes including CNS1S1, CSN2, CSN1S2 and CSN3 are clustered on chromosome 6. The Ks1-casein protein encoded by theCSN1S1 gene and known as candidate gene. The funding of different studies indicates the effect of ks1-casein gene on milk traits in goat. Khalkhali goat is one of the native dairy goats in Iran that is distributed in North West at Ardabil province. Due to less economically viable, the population of this breed have a declining trend. Therefore consider and attention to this breed is very important. K-casein gene is a useful genetic marker to improve animal breeding programs. The polymorphisms of k-casein gene have significant effect on milk composition and production. To the best of our knowledge, no study has yet considered the about casein gene in Khalkhali goats. This study aimed to assess the variation and polymorphisms at CSN3 loci on Khalkhali goats.
In this study for analyzing of polymorphisms in Kappa casein gene, 100 blood samples were collected from Khalkhali goats. Genomic DNA was extracted using DNA isolation kit for mammalian blood and the exon 4 of Kappa casein gene amplified using specific primers including: Forward primer F: 5’-GGT ATC CTA GTT ATG GAC TCA AT-3’ and revers primer R:5’-GTT GAA GTA ACT TGG GCT GTG T -3’. Genotyping were determined using PCR-SSCP and were sequenced through detection of different pattern. The sequences were analyzed using bioinformatics software’s. Estimates of evolutionary divergence between the sequences were conducted using the maximum composite likelihood method by using MEGA version 6.10 software. Phylogenetic tree was constructed using the Neighbor-Joining method by using the same software. Haplotype analysis and the network analysis of haplotypes was constructed using DnaSp 5.10 and Network 4.613 respectively.
The results of sequencing lead to identification of one polymorphic site in kappa casein gene sequences, that nucleotide C substituted by T in exon 4 of kappa casein gene which caused changing CCT codon to TCT, subsequently, based on IUPAC standard genetic code lead to conversion of Proline with Serine amino acid. Genetic diversity of Khalkhali goat was 0.524 which evidences intermediate genetic diversity in this breed. Comparison between species identified 41 mutations that cause 29 haplotype with 0.833 haplotype diversity. Nucleotide diversity and average nucleotide differences (K) among species were 0.04469 and 11.75436 respectively. The analyzing of 129 sequences of farm animal showed that the biggest haplotype is belong to Hap 1 and Hap 2 with 35 and 36 frequency respectively in capra hircus and Khalkhali goat population. Haplotype diversity, haplotype diversity variance, nucleotide diversity in each loci, , average of the number of nucleotide diversity (k) and tajima D were 0.833, 0.0004, 0.0447, 11.7544 and 1.5899 respectively. Tajima D was non-significant at p>0.1 that could be due to use of less samples in this analysis.
Genetic differentiate (Fst) and Genetic distance (DXY) between farm animal based on CSN3 gene were analyzed and the most genetic differentiate were observed between sheep and buffalo and also we estimated less and negative genetic differentiate between Khalkhali goat and capra hircus. That could be because of allele frequencies distribution in marker loci is not normal.
Results illustrated in this study could be useful in characterization of specific dairy products linked to the Khalkhali breed, which are certainly a suitable tool to conserve local breeds and biodiversity. based on mutation identified in k-casein gene and this substation caused changing in Amino acids and based on reports about this gene as good marker genetics in animal breeding programs, recommended that association of this mutation with milk traits would be investigated and if that is significant should be used in Khalkhali goat breeding program. These results could be preferred in future planning of breeding programs and selection schemes for enhancing economic traits.

The best way to maximize the profitability through breeding is using economical coefficients of characteristics with genetic assessment. One of the effective ways to increase profitability in animal husbandry is using livestock breeding. It is not possible to utilize breeding optimized method without considering relative importance of characteristics economically. On the other hand, the best way to determine the relative importance of characteristics is to calculate the economic coefficients. Economic Value of characteristic is the profit obtained from one unit genetic improvement of the average of a characteristic when other characteristics are held in their constant values. Bio-economic model is a set of equations which define the incomes and costs of the production system as a function of different characteristics. Simulation is a process in which a set of examinations are carried out by using a designed method on the basis of a real system in order to find out the system behavior and various approaches are assessed for its operation in a defined range.
The aim of the present study is to estimate the economic value of production and reproduction characteristics of dairy cows of Mohan cultivation, industry and animal husbandry based on collected data from 13000 dairy cows and market conditions in 2014 and by using a determined bio-economic model. The income factor included obtained incomes from milk sale, additional heifer sale, male calf, removed cows and fertilizer sale and the costs included nutrition, management and capital costs. The management costs included health and care, human forces and reproduction. Five different stages defined in animal life cycle. These stages including from birth to weaning, from weaning to the age calf sale (12th month), from weaning to the first insemination of female calf (18th month), from first insemination to first birth (alternative heifers) and productive cows more than two years old. The calculation of cost and revenue of the heifer per 18 months is carried out. The breeding period of calf, young cow and productive cow considered 12 months. In these herds, nutrition was done completely manually and in the place. Nutrition cost was calculated using energy requirements estimation equations AFRC (1991) by considering the consumed concentrate constant for productive cows, growing male and female calf and alternative heifers separately. In this system, artificial insemination is used for cows impregnate and reproduction cost considered as a function of interval of two births which indicates the number of insemination which resulted in impregnation. Health program included vaccination, deparasitation and quarantine. Male calf was sold based on each kilogram weight per each calf at a constant price. In present study, dairy cows in production system were categorized in seven different age groups of 2, 3, 4, 5, 6, 7, 8 and then revenues, costs, final profit and economic value of characteristics calculated for every age group separately. The studied characteristics include milk production, fat milk production, age of the first birth, calf birth interval, increasing daily weight before and after weaning, birth weight, matured calf weight and live rate before and after weaning. The bio-economic model designed based on breeding and information system of herd and economic coefficients calculated by matlab software. Economic value of each characteristic estimated based on the changes in annual profit of production system per one unit increase in the average of the considered characteristic while other characteristics are kept constant. First, all of the revenues and costs and profit and herd combination determined and the input files saved and the program ran.
Annual revenues and costs calculated based on different age groups and the annual profit was 15966572/69 Rials for each productive cow. Among revenue resources, 71% was for milk sale and its components, 10% for removed cow sale, 11% for male calf sale, 6% for additional heifer sale and 2% for fertilizer sale. Among variable costs 68% was for nutrition costs, 17% for work force cost and livestock sale and 10% for health and reproduction costs. Economic values of production and reproduction characteristics including milk production, milk fat production, age of first birth, calf birth interval, daily weight increase after and before weaning, birth weight, matured calf weight and live rate before and after weaning estimated 4718/59, 144757/8, -30756/52, -86789/17, 1284/45, 34/57, 9894/16, -1900/13, 5808 and 107521/9 Rials per each cow respectively. The highest relative importance related to production characteristics (54/37%) and after that reproduction (21.98%), durability (20/56%) and the least amount estimated for growth (3/07%). Characteristics can be divided into several groups based on the impact on revenues and costs. Economic values of production and reproduction characteristics including milk production, milk fat production, age of first birth, calf birth interval, daily weight increase after and before weaning, birth weight, matured calf weight and live rate before and after weaning estimated 4718/59, 144757/8, -30756/52, -86789/17, 1284/45, 34/57, 9894/16, -1900/13, 5808 and 107521/9 Rials per each cow respectively. The highest relative importance related to production characteristics (54/37%) and after that reproduction (21.98%), durability (20/56%) and the least amount estimated for growth (3/07%). Characteristics can be divided into several groups based on the impact on revenues and costs. A group of characteristics increase the revenue and cost of production system and also increase the profit compared with the initial state (initial value). Most of the production characteristics such as milk production, fat, increase of weight before and after weaning, birth weight and live rate before and after weaning are placed in these groups. However, by increasing one unit of matured cow weight, the revenue and costs are increased and but the obtained profit is decreased. Characteristics of the second group do not impact the revenue but the costs of production system increased by increasing its average which include the age of the first birth. The third group includes the characteristic of interval between two births and the revenue decreased, system costs increased and profit decreased by increasing its average.
Increase in the average unit production and reproduction traits have different effects on revenue, cost and profitability of production systems.

The parturition is a very important stage in the longevity of cows and related to future animal health. The health parturition and avoid dystocia are main issues that needed to attention in farms. Prolonged or difficult parturition called dystocia and effects on the profitability of herds, animal welfare and admissibility of the production system of consumers. Dystocia is the main cause of stillbirth, death of cattle and calves and decreasing fertility, also have a negative effect on the reproductive traits (such as higher days open and number of inseminations per conception). This situation can also lead to increasing risk of infertility, the outbreak of diseases after parturition, culling probability and cost of veterinary. Although dystocia is one of the most important problems in dairy cattle production system and had major economic losses in the dairy industry. Thus, the objective of this study was to estimate genetic and environmental correlations between dystocia and production traits (milk, fat and protein production), reproduction (calving interval, calving to first service, fist service to conception) and birth weight in Holstein cattle of Iran with Bayesian linear- threshold model.
In this study, data collected by Animal breeding center of Iran during 1989 to 2012 were used. The dystocia was considered as traits for the mother and the service sire was fitted for this trait as an additional random effect. After edition of records, dystocia (threshold with 5 scores) with other traits (linear) were analyzed as bivariate analysis by Gibbs sampling method via DMU software. Gibbs chains with 300000 iterations were generated, with an initial discard of 20000 samples and a sampling interval of 120 iterations. Therefore, each analysis 2500 samples of (Co) variance components were obtained. The convergence checking of the chains generated by the Gibbs sampler was done using graphical analysis and diagnosis tests available in the Bayesian output analysis program (BOA).
Maximum frequency of dystocia was related to unassisted calvings (80.35%) and only 19.65 % of calving were performed with assistance. Among calving that require to assistance, the highest number was for assistance with no damage (11.43 %) and 8.22 % of calvings require a lot of assistance. The posterior mean of heritabilities for milk, fat, protein, calving interval, calving to first service, first service to conception, birth weight and dystocia were 0.175, 0.120, 0.126, 0.050, 0.040, 0.004, 0.128 and 0.012, respectively. According to the estimated heritability, the genetic selection for production traits and birth weight can be somewhat effective, but it will not observe appropriate response for reproductive traits and dystocia. The genetic correlation between dystocia with production traits were estimated low and negative (exception of fat). Low genetic correlations between traits showed that these traits were not influenced by same genes. The highest genetic correlation was estimated between dystocia and birth weight that showing similar genes affected for these traits and dystocia was increased due to increasing of birth weight. The genetic correlation between dystocia with calving to first service and first service to conception were obtained positive and negative, respectively, indicating that dystocia can be increase calving to first service and decreased first service to conception. Increasing of calving to first service interval can be created opportunity for improvement of anatomical conditions of the animal, thus first service to conception could be decreased due to the improvement of the conception rate.
Recent study showed that estimated heritability for production traits and birth weight were high and it was low for reproduction traits and dystocia. The results indicated that improvement of environmental conditions was necessary for the improvement of reproduction traits and dystocia. The highest genetic correlation between dystocia and birth weight suggested that improvement of birth weight increases dystocia. Increasing of calving to first service and reducing first service to conception after dystocia is expected due to genetic correlation estimates for these traits with dystocia.