فهرست مطالب

  • سال بیست و نهم شماره 3 (پاییز 1398)
  • تاریخ انتشار: 1398/09/01
  • تعداد عناوین: 9
|
  • محمد حامد شهسواری، غلامعلی مقدم*، حسین دقیق کیا، آناپائولا ریبیرو رودریگز، مجتبی دشتی زاد صفحات 1-16
    زمینه مطالعاتی

    تناقض های بسیاری در رابطه با اثرات مثبت یا منفی جسم زرد و فعالیت نابرابر دو سمت دستگاه تولید مثلی وجود دارد.

    هدف

    هدف از این مطالعه بررسی اثرات جسم زرد و سمت تخمدان (راست در برابر چپ) بر ویژگی های بافت شناسی انواع مختلف فولیکول های پره آنترال بعد از فرآیند انجماد بافت تخمدان گاوی به روش شیشه سازی بوده است.

    روش کار

    قطعات تخمدانی از هر یک از جفت تخمدان ها استحصال شدند. در گروه کنترل تازه نمونه های بافتی بلافاصله برای آنالیزهای بافتی  تثبیت شدند در حالی که در گروه های تحت فرآیند انجماد به روش شیشه سازی [گروه های فاقد جسم زرد، واجد جسم زرد، راست و چپ] که سپس 1 یا 5 روز مورد کشت برون تنی قرار گرفتند، بافت های تخمدانی قبل و بعد از کشت تثبیت شده و از لحاظ بافت شناسی مورد بررسی قرار گرفتند.

    نتایج

    نتایج این آزمایش نشان داد که اگرچه عدم حضور جسم زرد در تخمدان منجربه وقوع درصد بالاتری از فولیکول های نرمال از نوع انتقالی (نمونه های کشت داده شده در روز 1) و اولیه (نمونه های گرم سازی شده) نسبت به نمونه هایی که از تخمدان های واجد جسم زرد گرفته شده است، شد اما یک مورد استثناء هم وجود داشت. این نتایج نشان دادند که در نمونه های بدست آمده از تخمدان های واجد جسم زرد، درصد بالاتری از فولیکول های مادری اولیه نرمال (نمونه های کشت داده شده در روز 1) نسبت به تخمدان های فاقد جسم زرد مشاهده می شود (به ترتیب 6/57 % در برابر 3/39 %). اگرچه برای تمامی انواع فولیکول های پره آنترال در تمامی مراحل آزمایش (گرم سازی، روز 1 یا 5 کشت برون تنی) هیچ تفاوت معنی داری از لحاظ درصد فولیکول های نرمال بین دو گروه راست و چپ وجود نداشت (0/05˃P).  

    نتیجه گیری نهایی

    براساس نتایج بدست آمده از این مطالعه اینگونه میتوان استنتاج کرد که بسیاری از عوامل همچون حضور یا عدم حضور یک جسم زرد، نوع و رده فولیکول های پره آنترال، مراحل پس از انجماد (گرم سازی و روزهای کشت داده شده) و اثر متقابل بین این عوامل می توانند میزان موفقیت نتایج حاصل از انجماد به روش شیشه سازی را متاثر سازند.

    کلیدواژگان: جسم زرد، انجماد به روش شیشه سازی، کشت برون تنی، فولیکول انتقالی، فولیکول اولیه
  • محمد خواجه بمی، محسن افشارمنش* صفحات 17-30
    زمینه مطالعاتی

    روی و پروبیوتیک ها نقش مهمی در عملکرد و سیستم ایمنی طیور دارند.

    هدف

    این تحقیق به منظور بررسی اثرات نانو ذرات اکسید روی و پروبیوتیک (باسیلوس کوآگولانس) بر پاسخ ایمنی، خصوصیات لاشه و وزن برخی اندام های داخلی جوجه های گوشتی انجام شد.

    روش کار

    این پژوهش با 288 قطعه جوجه گوشتی نر راس 308 در قالب طرح کاملا تصادفی با 6 تیمار، 4 تکرار و 12 جوجه در هر تکرار به اجرا درآمد. تیمارها شامل: شاهد (حاوی 100 میلی گرم در کیلوگرم اکسید روی)، شاهد + 100 میلی گرم در کیلوگرم پروبیوتیک و جیره پایه بدون اکسید روی + 25 و 50 میلی گرم در کیلوگرم نانو اکسید روی با و بدون پروبیوتیک بودند. در این آزمایش فراسنجه های عملکردی (افزایش وزن بدن، مصرف خوراک و ضریب تبدیل خوراک)، ایمنی همورال (تیتر آنتی بادی علیه گلبول قرمز گوسفند (SRBC)، فراسنجه های لاشه (وزن نسبی لاشه، سینه، ران، طحال، کبد، پانکراس، بورس فابریسیوس و همچنین وزن و طول نسبی دوازدهه، ایلئوم و سکوم) و  pHروده و سنگدان محاسبه گردید.

    نتایج

    استفاده از نانو اکسید روی با پروبیوتیک سبب بهبود افزایش وزن بدن و ضریب تبدیل خوراک جوجه های گوشتی شد (P<0/05). وزن نسبی کبد و ران ها در جوجه های تغذیه شده با نانواکسید روی به همراه پروبیوتیک به ترتیب کمتر و بیشتر از جوجه های مربوط به گروه شاهد بود (P>0/05). تیتر آنتی بادی علیه گلبول قرمز گوسفند در جوجه های تغذیه شده با 50 میلی گرم در کیلوگرم نانو اکسید روی با و بدون پروبیوتیک بیشتر از گروه شاهد بود (P<0/05).

    نتیجه گیری نهایی

    به طورکلی استفاده از 50 میلی گرم در کیلوگرم نانو اکسید روی به همراه پروبیوتیک سبب بهبود عملکرد، خصوصیات لاشه و تقویت پاسخ سیستم ایمنی شد.

    کلیدواژگان: پروبیوتیک، جوجه های گوشتی، سیستم ایمنی، نانو ذرات اکسید روی
  • فاطمه آذری، فرهاد فرخی اردبیلی* صفحات 31-42
    زمینه مطالعاتی

    انرژی جیره غذایی در دوره پیش از آبستنی عاملی تاثیرگذار بر فعالیت های تولیدمثلی است.

    هدف

    بررسی اثر افزایش سطح انرژی جیره با استفاده از منابع کربوهیدراتی یا مکمل چربی بر فعالیت های تخمدانی و برخی فراسنجه های خونی میش های قزل.

    روش کار

    این آزمایش با استفاده از 12 راس میش بالغ قزل در قالب طرح کاملا تصادفی در 4 گروه 3 راسی انجام شد.  جیره ی غذایی گروه شاهد مطابق با احتیاجات انرژی نگهداری و جیره ی غذایی سایر گروه های باهدف تامین 20 درصد انرژی بیشتر نسبت به نیاز نگهداری تنظیم شد. در گروه دوم، دانه ی جو به عنوان منبع انرژی و در تیمارهای سوم و چهارم بخشی از دانه ی جو به ترتیب با نمک های کلسیمی غنی از اسیدهای چرب امگا-3  و امگا-6 جایگزین شدند. همزمان سازی چرخه استروس میش ها با دو تزریق متوالی پروستاگلاندین انجام و معاینه سونوگرافی تخمدان ها از روز تزریق دوم پروستاگلاندین شروع و به مدت سه چرخه کامل ادامه یافت. تغذیه گروه های آزمایشی با جیره های اختصاصی از ابتدای چرخه دوم آغاز و تا انتهای چرخه سوم ادامه یافت. خونگیری در روز 12 فاز لوتئال در هر سیکل، حدود 4 ساعت پس از خوراک دهی صبح انجام شد.

    نتایج

    شاخصه های مختلف چرخه استروس میش ها شامل تعداد موج های فولیکولی، طول چرخه استروس، قطر فولیکول تخمک گذاری کننده و تعداد تخمک گذاری در گروه های آزمایشی به طور معنی داری تحت تاثیر سطح انرژی جیره و منبع آن قرار نگرفت (P>0/05). با این حال، تغییر در سطح انرژی جیره و منبع تامین آن تاثیر معنی داری بر الگوی اسیدهای چرب و غلظت برخی فراسنجه های پلاسما داشت (P<0/05).

    نتیجه گیری نهایی

    به طور کلی براساس نتایج تحقیق حاضر تغذیه طولانی مدت میش ها با جیره حاوی انرژی بالا و با منبع مختلف هرچند برروی فراسنجه های مختلف خون تاثیر معنی داری داشت ولی دینامیسم فولیکولی آنها را بطور قابل توجهی تحت تاثیر قرار نداد.

    کلیدواژگان: اسیدهای چرب امگا-3، اسیدهای چرب امگا-6، فعالیت تخمدانی، سونوگرافی
  • محمد تقی کریمی، رضا ولی زاده*، عباسعلی ناصریان صفحات 43-59
    زمینه مطالعاتی

    یکی از راهبردهایی که می تواند در راستای عمل آوری و استفاده بهینه از منابع علف نی موجود در حاشیه رودخانه ها جهت تغذیه دام و بهبود وضعیت تغذیه گله های گوسفند و بز کشور توسعه یابد، استفاده از فناوری تهیه بلوک های خوراکی است.

    هدف

    هدف از این مطالعه، ارزیابی تاثیر جیره حاوی علف نی (Phragmatis australis) در قالب بلوک خوراک کامل بر رشد و عملکرد بره های بلوچی بود.

    روش کار

    تعداد 30 راس بره نره بلوچی با میانگین سنی 5-6 ماه و وزنی 9/2±28 کیلوگرم با جیره های کامل بر پایه 30 درصد علوفه و 70 درصد کنسانتره تغذیه شدند. جیره های آزمایشی شامل 1) خوراک مخلوط کامل حاوی یونجه و کاه گندم (جیره شاهد)، 2) بلوک خوراک کامل حاوی علف نی (جیره بلوک) و 3) خوراک مخلوط کامل حاوی علف نی (جیره مخلوط) بود. آزمایش در قالب طرح کاملا تصادفی با سه تیمار و ده تکرار انجام شد.

    نتایج

    در مقایسه با جیره مخلوط، جیره بلوک میانگین افزایش وزن روزانه، میانگین مصرف خوراک روزانه، قابلیت هضم مواد مغذی، نیتروژن آمونیاکی شکمبه، اسیدهای چرب فرار شکمبه، جمعیت پروتوزوآهای شکمبه و نیتروژن اوره ای خون را به طور معنی داری افزایش داد (0/05>P). تفاوت معنی داری بین جیره های شاهد و بلوک از نظر صفات ذکر شده مشاهده نشد. سایر صفات بیوشیمیایی خون و مقدار pH شکمبه در محدوده طبیعی برای این نوع از دام ها بود. در مقایسه با جیره مخلوط، نرخ خوردن، نشخوار و کل فعالیت جویدن در بره های تغذیه شده با جیره بلوک بیشتر بود (0/05>P).

    نتیجه گیری نهایی

    نتایج این آزمایش نشان داد که می توان با استفاده از فناوری تهیه بلوک های خوراکی و از طریق جایگزینی یونجه و کاه گندم با علف نی ضمن تغذیه دام ها با هزینه کمتر در مناطق دارای پتانسیل رشد سطوح مختلف علف نی به بهبود اقتصاد مردم ساکن در این نواحی و مجموع تولیدات دامی کشور کمک کرد.  

    کلیدواژگان: بره بلوچی، پروتوزوآ، خوراک کامل بلوک، فعالیت جویدن، علف نی
  • نیلوفر راستی دوست، سعید نیک بین*، بهمن نوید شاد، قربان الیاسی صفحات 61-70
    زمینه ی مطالعاتی

    نوروپپتیدY یک نوروترنسمیتر در هیپوتالاموس است که نخستین بار از هیپوتالاموس مغز خوک استخراج شد و محرک اشتها و موثر بر هورمون های تولیدمثلی است.

    هدف

    هدف این مطالعه، توالی یابی و بررسی ارتباط ژن NPY  با صفات تولیدمثلی در بوقلمون های بومی ایران است. این صفات شامل وزن توده ی تخم تولیدی، طول دوره ی تخم گذاری، سن بلوغ جنسی و وزن اولین تخم می باشد.

    روش کار

    120 بوقلمون ماده به طور تصادفی از ایستگاه تحقیقات بوقلمون استان آذربایجان شرقی انتخاب شد و رکوردهای تولید مثلی آنها ثبت شد. از نمونه ی خون بوقلمون ها برای استخراج  DNAاستفاده شد. قطعه ی 725 جفت بازی ژن  NPY با استفاده از پرایمرهای طراحی شده ی اختصاصی تکثیر شد. چندشکلی ژن NPY با توالی یابی محصولات PCR بررسی شد.

    نتایج

    4 جایگاه چندشکلیC552T ، T544A، T360G  و C367A در توالی ژن  NPYیافت شد. نتایج ارتباط معنی داری بین جایگاه T360G با صفت وزن کل تخم نشان داد و چندشکلی A544T ارتباط معنی داری با وزن تخم و طول دوره ی تخم گذاری داشت.

    نتیجه گیری نهایی

    در نتیجه چندشکلی های جدیدی در ناحیه اینترونی ژن NPY  مشخص شد که  بر صفات وزن کل تخم، تعداد تخم و طول دوره تخم گذاری تاثیر داشت. نتایج این پژوهش می تواند در برنامه های اصلاح نژادی  بوقلمون های بومی شمال غرب ایران مورد توجه قرار گیرد.

    کلیدواژگان: چندشکلی، بوقلمون، نوروپپتید y، طول دوره ی تخمگذاری، وزن تخم
  • طناز طالبی، جمال سیف دواتی*، صیاد سیف زاده، فرزاد میرزایی آقجه قشلاق، حسین عبدی بنمار، رضا سید شریفی صفحات 71-86
    زمینه مطالعاتی

    افزودن پودر گیاهان داروئی آویشن و حبه سیر می تواند بر  قابلیت هضم و گاز تولیدی علوفه های اسپرس و یونجه در شرایط آزمایشگاهی تاثیر گذار باشد.

    هدف

    این آزمایش برای بررسی تاثیر سطوح مختلف افزودن پودر آویشن و پودر حبه سیر بر قابلیت هضم و گاز تولیدی در شرایط آزمایشگاهی انجام شد.

    روش کار

    در این مطالعه سطوح مختلف پودر آویشن و پودر سیر (صفر، 5/1 و 3 درصد) به سرنگ های 100 میلی لیتری حاوی علوفه های یونجه، اسپرس و مخلوط یونجه و اسپرس افزوده شد و میزان گاز تولیدی با انکوباسیون سرنگ ها در زمان های 2، 4، 6، 8، 12، 24، 48، 72 و 96 ساعت بررسی  و داده های حاصل در قالب طرح کاملا تصادفی تجزیه و تحلیل شدند.

    نتایج

    افزودن 5/1 درصد پودر آویشن و سیر به علوفه اسپرس سبب بهبود قابلیت هضم ماده خشک، ماده آلی قابل هضم، قابلیت هضم ماده آلی در ماده خشک و انرژی متابولیسمی در مقایسه با شاهد گردید (0/05>P). همچنین افزودن 3 درصد پودر سیر افزایش معنی داری را در قابلیت هضم ماده آلی در ماده خشک و انرژی متابولیسمی نسبت به شاهد نشان داد (0/05>P). نتایج نشان داد که افزودن 5/1 و 3 درصد سیر به علوفه اسپرس کمترین میزان ماده آلی قابل هضم، اسید چرب کوتاه زنجیر، انرژی متابولیسمی، پتانسیل تولید گاز و نرخ تولید گاز در مقایسه با سایر تیمارها شد (0/05>P). همچنین نتایج نشان داد که 3 درصد سیر در علوفه یونجه کمترین میزان ماده آلی قابل هضم، اسید چرب کوتاه زنجیر، انرژی متابولیسمی و پتانسیل تولید گاز در مقایسه با شاهد داشت (0/05>P). مخلوط یونجه و اسپرس تحت تاثیر معنی داری افزودن افزودنی های گیاهی در مقایسه با شاهد قرار نگرفت.

    نتیجه گیری نهایی

    استفاده از سطوح 5/1 درصد آویشن و سیر سبب بهبود قابلیت هضم شد. همچنین استفاده از 3 درصد سیر کاهش میزان گاز تولیدی و فراسنجه های تخمیری حاصل از تست گاز را به دنبال داشت.

    کلیدواژگان: آویشن، اسپرس، انرژی متابولیسمی، سیر، قابلیت هضم و یونجه
  • سعید خلجی* صفحات 87-104
    زمینه مطالعاتی

    بررسی اثر مخلوط  گیاهان دارویی و اسیدهای آلی در جوجه های گوشتی.

    هدف

    بررسی اثر افزودن مخلوط سیاه دانه و پونه با اسید فرمیک پوشش دار (فیتوسید)با هدف بهبود سلامتی دستگاه گوارش و عملکرد جوجه های گوشتی.

    روش کار

    آزمایش در قالب طرح کاملا تصادفی شامل4 تیمار بصورت جیره آردی و 4 تیمار بصورت جیره پلت در 4 تکرار و 7 پرنده در هر واحد آزمایشی انجام شد. تیمارها شامل تیمار کنترل، کنترل به همراه1 گرم فیتوسید در هرکیلوگرم خوراک، کنترل به همراه 2 گرم فیتوسید در هرکیلوگرم خوراک و کنترل به همراه 500 گرم سالینومایسین در هرکیلوگرم خوراک. افزایش وزن، خوراک مصرفی و ضریب تبدیل غذایی جوجه ها در سنین مختلف در هر واحد آزمایشی مورد اندازه گیری قرار گرفت. همچنین فراسنجه های خونی در 21 و 42 روزگی، مورفولوژی روده در 42 روزگی و جمعیت میکروبی ایلئوم و سکوم در 7 و 21 روزگی اندازه گیری شد.

    نتایج

    افزودن فیتوسید بطور معنی دار باعث افزایش وزن بدن و خوراک مصرفی و کاهش معنی دار ضریب تبدیل غذایی در جوجه های تغذیه شده با خوراک آردی و پلت شد (0/01>P). افزودن فیتوسید همچنین pH ژژنوم و ایلئوم را بطور قابل توجهی کاهش داد (0/01>P). افزودن فیتوسید در جیره های پلت سطح اسید اوریک و ازت اوره ای خون جوجه های گوشتی را بطور معنی داری  کاهش داد. افزودن فیتوسید به جیره های پلت و آردی منجر به کاهش بسیار معنی دار جمعیت باکتری های سالمونلا، کلی فرم و اشریشیاکلی در 7 و 21 روزگی در ایلئوم و نیز سکوم جوجه های گوشتی شد. فیتوسید بطور معنی داری طول پرزهای ایلئوم را افزایش داد.

    نتیجه گیری نهایی

    بطور کلی نتایج بدست آمده نشان داد که مخلوط گیاه دارویی با اسید آلی میتواند در سلامتی دستگاه گوارش نقش قابل توجهی داشته باشد.

    کلیدواژگان: اسید فرمیک، ایمنی، پونه و سیاه دانه، جوجه گوشتی، سلامتی روده، فیتوسید
  • سید عباس رافت، حمید کریمی*، جلیل شجاع، فاطمه بالازاده کوچه صفحات 105-118
    زمینه مطالعاتی

    در این مطالعه به بررسی اثرات سطح تغذیه و سن بر روی رشد الیاف بز رائینی با استفاده از روش های بافت شناسی پرداخته شده است.

    روش کار

    برای این منظور 24 راس بز رائینی از شهرستان بافت تهیه شد. حیوانات به چهار گروه تغذیه ای تقسیم شدند. الف- 7/0 احتیاجات تغذیه ای (M 7/0) ب- در حد احتیاجات تغذیه ای (M) ج- 4/1 احتیاجات تغذیه ای (M4/1) د- 8/1 احتیاجات تغذیه ای (M8/1). برای اندازه گیری  قطر الیاف از روش میکروپروژکسیون استفاده شد. جهت مطالعه پراکندگی فولیکول های مو در روی پوست، از ناحیه میانی سمت چپ، بیوپسی گرفته شد. سپس بلو ک های پارافینی به روش معمول بافت شناسی تهیه شدند. سپس مقاطع بافت شناسی تهیه شده با استفاده از رنگ آمیزی ساک پیک رنگ آمیری شدند..

    نتایج

    اثر سطح تغذیه و سن بر روی میزان رشد الیاف در واحد سطح، درصد فعالیت فولیکو ل های ثانویه، طول الیاف کشمیر و درصد الیاف کشمیر معنی دار نبود. در نمونه های الیاف شهریور ماه، میانگین قطر کشمیر گروه M 7/0به طور معنی داری کمتر از گروه های(1/8M ,1/4M ,M ) دیگر بود. افزایش سطح تغذیه بیشتر از حد نگهداری، باعث افزایش مقدار کشمیر تولیدی نشد. میانگین قطر کشمیر در خرداد ماه افزایش معنی داری نسبت به ماه قبل نشان داد . بیشترین مقدار الیاف تولیدی در واحد سطح به ماه های خرداد و تیرتعلق داشت. نسبت فولیکول های ثانویه به اولیه در این تحقیق 6/12محاسبه گردید.

    نتیجه گیری نهایی

    نتایج حاصل از این بررسی به طور کلی نشان داد که پرورش بزهای کرکی رائینی در اقلیم استان اذربایجان شرقی نمی تواند باعث ایجاد تغییرات اساسی در قطر و طول کشمیر در مقایسه با بزهای کرکی رائینی استان کرمان شود.

    کلیدواژگان: الیاف، بز کرکی رایینی، تغذیه، سن
|
  • MH Shahsavari, Gh Moghaddam *, H Daghigh Kia, AP Ribeiro Rodrigues, M Dashtizad Pages 1-16
    Introduction

    The success of ovarian tissue cryopreservation can be recognized by the live birth in different animal species (mice, rabbit, birds, sheep, and human). In spite of all the advances of cryopreservation of ovarian tissue, it is still a challenge and protocols should be optimized to handle the diversity of cell types and components of this tissue (oocyte, granulosa cells, endothelial cells, extra cellular matrix) and the biological variability among species. It was reported that there was a relationship between the development of corpus luteum (CL) and the development of follicles, which may cause asymmetry in the function of the reproductive organs in dairy cows. Previous studies confirmed asymmetry in the function of reproductive system in dairy cows due to differences in ovarian activity and probably because of physiological differences in the tubular parts of reproductive organs which result from the side of the previous gestation. There are many discrepancies about positive or negative effects of corpus luteum and unequal activity of sides of the reproductive system. Therefore, the aim of this study was to investigate the impacts of CL and side of ovaries (Right vs. Left) on histological characteristics of different types of preantral follicles after bovine ovarian tissue vitrification.  

    Material and methods

    Ovaries (n=10) were collected from five adult cross-bred cows at a local abattoir. Ovaries were categorized on the basis of the presence or absence of a CL and the side of ovaries and divided into five pools: 1/CL+ (with CL) group, 2/CL -(without CL) group, 3/right ovaries group, 4/left ovaries group and 5/C control group (ovaries which were not selected toward the presence or absence of CL or side of ovaries). From each bovine ovarian pair, fragments were recovered and immediately fixed for analysis (fresh control) or submitted to vitrification [CL (˗); CL(+); Right and Left group), either followed by in vitro culture for 1 or 5 days. Samples were fixed in Millonig’s for 2 h, dehydratedin a graded series of ethanol, clarified with xylene,embedded in paraffin wax, and serially sectioned into 7 µmsections. Every fifth section was mounted on a glass slide,stained with Periodic acid–Schiff (PAS), and evaluated usinga light microscope at magnificationof 400×. All procedures for exposure to cryoprotectant agents (CPAs) and vitrification were performed by using the new Ovarian Tissue Cryosystem (OTC). For the in vitro culture, the cortex tissue samples weretransferred to 24-well culture dishes containing 1 mLof the culture medium per well. The culture wasperformed at 38.5 °C in 5 % CO2 in a humidifiedincubator. The ovarian tissue was histologically evaluated before and after culture. The quality of the preantral follicles wasclassified according to the parameters previously described. Briefly, morphologically normal folliclescontained an intact oocyte and granulosa cells, whereasdegenerated follicles contained an oocyte with a pyknoticnucleus, ooplasma shrinkage and/or granulosa cell layers that had disorganized and detached from the basementmembrane. In each treatment, a total of 150 preantral follicles (30 per animal) were examined, which were classified as follicles without an antrum and with an oocyte, surrounded by one layer of flattened (primordial follicle), flattened and cuboidal (transitional follicle) or cuboidal granulosa cells (primary follicle), or with an oocyte surrounded by two or more layers of cuboidal granulosa cells (secondary follicle). In this study, data that were not normally distributed (Kolmogorov-Smirnov test), were submitted to logarithmic transformation. Comparisons of means (morphologically normal follicles) were analyzed by Kruskal-Wallis test and Mann-Whitney test, when appropriate. All statistical tests were performed using Sigma Plot 11 (Systat Software Inc., USA). Differences were considered significant when P< 0.05.

    Results and discussion

    Results of this experiment showed that although, absence of a CL (CL˗) resulted in a greater percentage of normal follicles for transitional (cultured samples on day 1) and primary follicles (post-thawed samples) when compared to that of ovaries bearing a CL (CL+), there was an exception. These results indicate that CL (+) samples also resulted in a greater percentage of normal primordial follicles (cultured samples on day 1) than that of CL (˗) samples (57.6% versus 39/3%, respectively). However, for all classes of preantral follicles during all stages (warming, day 1 or day 5), there were no significant differences in the percentages of normal follicles among Right and Left samples (P> 0.05).

    Conclusion

    It seems that follicles which are at beginning of their development (Primordial follicles) were not affected by presence of a CL as much as follicles at more advanced stages of development (transitional & primary). According to the results of this study, it can be concluded that, many factors such as presence or absence of a CL, types of preantral follicle classes, stages after vitrification (warming and days after culture) and interactions between these factors could influence the likelihood of a successful vitrification outcome.

    Keywords: Corpus luteum, In vitro culture, Primary follicles, Transitional follicles, Vitrification
  • M Khajebami, M Afsharmanesh * Pages 17-30
    Introduction

    Zinc (Zn) is an essential trace element for poultry nutrition, because of its important role in various biological functions. For decades, the nutritional importance of Zn has been known, but its vital roles in immune modulation and functioning has been arisen (Bonaventura et al. 2015). The forms of Zn in the diet of poultry could be as inorganic form like Zinc oxide (ZnO) and Zinc Sulphate and as organic shapes like Zn acetate (Zhao et al. 2014). A new form of this inorganic salt is zinc oxide nanoparticles (zno nanoparticles) that have produced by nanotechnology (Song et al. 2010). Nanoparticles have larger surface area that allows higher interactions with other molecules, and the larger surface area enhances the bioavailability and the intestinal absorption of these tiny structures (Nel et al. 2009; Tsai et al.  2016). In general, little studies have indicated that the application of nano minerals in broilers production, immune responses is promising. One of the most promising spore forming lactic acid-producing species is Bacillus coagulans (B. coagulans) (Hyronimus et al.  2000). Bacillus coagulans is a safe, unique gram-positive, spore-forming, microaerophilic, lactic acid producing bacillus that does not encode enterotoxin. It possesses a protective, spore-like protein coating, which allows it to resist high temperature and to survive stomach acid and bile salts, reach the small intestine, germinate, and multiply (Hyronimus et al.  2000). It has been demonstrated that supplementation of B. coagulans in chicken feed promotes their growth performance (Hung et al. 2012). Some previous studies reported that probiotics could effectively enhance immune functions of broiler chicks. Kabir et al. (2004) found that broiler chicks fed with probiotic improved antibody titers against sheep red blood cells (SRBC). In addition, researchers have used probiotics in combination with some nanoparticles, such as nano-selenium, to improve the growth performance and immunity in broiler chicks (Saleh, 2014). In addition, another research demonstrated that probiotics decreased intestine pH, hence it increased production of short-chain fatty acids because of the modification of the gut flora with a consecutive increased mineral solubility and absorbability (Gilman and Cashman 2006; Scholz-Ahrens et al. 2007). According to the above evidences, it appears that combination of zno nanoparticles with probiotic probably causes synergism effects between them through their impact on performance. Thus, in the current study, the synergistic effects of zno nanoparticle in combination with a probiotic on the growth performance and immune responses of broilers was studied. Therefore, the aims of current study were to evaluate the effects of B. coagulans and different levels of zno nanoparticles on growth performance, carcass characteristics, and immune responses parameters.

    Material and methods

    This trial was conducted with 288 male Ross broiler chicks in a completely randomized design with 6 dietary treatments and 4 replicates with 12 birds per replicate. The experimental treatments were included: control diet (100 mg/kg zno), control diet plus 100 mg/kg probiotic, basal diet without zno plus 25 and 50 mg/kg zno nanoparticles with or without probiotic. The basal diet was formulized according to the dietary requirements in accordance with the Ross guidelines. In this experiment the performance parameters (body weight gain, feed intake and feed conversion ratio), humoral immune (antibody titer against sheep red blood cells), carcass parameters (relative weight of carcass, breast, thigh, spleen, liver, pancreas, bursa of Fabricius and the relative weight and length of the duodenum, ileum and cecum) and intestinal and gizzard pH were measured. On day 42 of experiment, two birds from each replicate were selected, then weighed, were slaughtered and carcass parameters were weighed using a digital scale and their relative weight to body weight were calculated. The length of the various parts of the small intestine was measured after the separation from the mesenteric with the ruler. The collected data were compared using SAS software version 9.1.

    Results and discussion

    Using zno nanoparticles with probiotic improved body weight gain and feed conversion ratio of broiler chicks (P<0.05). It has been demonstrated that supplementation of B. coagulans in chicken feed promotes their growth performance (Hung et al.  2012). In other study, broiler chicks fed multi-strain probiotic diets have greater body weight gain and lower feed conversion ratio than those fed control diet (Zhang and Kim 2014). Jawad et al. (2016) were indicated that supplementation with probiotic improved body weight gain and feed conversion ratio. The possible mechanism for this improvement is that probiotic exert useful effect via retention of beneficial bacterial population in the digestive tract and improvement of feed digestion and absorption. In the present study, treatments had no significant effect on relative weight of carcass, breast, spleen, bursa of Fabricius, pancreas, and liver (P>0.05). The relative weight of liver and thighs in broiler fed with combination of zno nanoparticles and probiotic were lower and higher than control group, respectively (P<0.05). It was reported that using probiotic (Primalac) to the diet of broilers had no effect on growth performance, carcass quality, carcass weight, carcass traits, breast, heart, abdominal fat, spleen, and bursa of Fabricius (Shirmohammad et al. 2015). In addition, treatments had no significant effect on relative weight and length of different parts of small intestine (duodenum, ileum, and cecum) and pH of gizzard and cecum of broilers (P>0.05). The antibody titer against SRBC in chickens fed with 50 mg/kg of zno nanoparticles with or without probiotic were significantly more than the control group. In other study, the variation in Zn levels affected the antibody titers against SRBC inoculation and the amounts of humoral immune response. The highest antibody titers in broiler were observed at 80 mg/kg level compared with lower levels (Sunder et al. 2008). Changes in Zn status of body influenced the T cell functions and the balance between the different T helper cell subsets (Bonaventura et al. 2015).

    Conclusion

    In conclusion, the results showed that the use of 50 mg/kg of zinc oxide nanoparticle with probiotic (Bacillus coagulans) caused an improvement in growth performance, some carcass characteristics, and immune responses of broiler chickens. In addition, we concluded that substitution of the mineral form (zinc oxide) with zinc oxide nanoparticle in broiler diet did not affect the broiler performance.

    Keywords: Broiler chicks, Immune system, Probiotic, Zinc oxide nanoparticle
  • F Azari, F Farrokhi Ardabili * Pages 31-42
    Introduction

    Excellent reproductive performance is paramount to profitable farm animal production systems. This is particularly true in strict seasonal reproductive systems where animals are expected to establish and maintain pregnancy within a short period of time. Low reproductive performance in seasonal breeders such as sheep and goat was considered as a main economic problem in modern and nomadic production systems. There are numerous research reports on the impact of nutrition on follicular population, folliculogenesis, and ovulation rate in sheep. Feeding is a low-cost system for managing reproduction and ovulation rates in arid and semi-arid regions (Martin et al. 2004). Animal energy balance and its secondary effect on metabolism through its influence on nutrient concentrations, hormones and various growth factors such as calcium, insulin, growth hormone and insulin-like growth factor may be the most important mechanism to justify the effect of energy on processes Reproduction affected the hypothalamic-pituitary-ovarian axis. Dietary energy in pre-conception period is an influential factor in reproductive activities. Also, there are reports about the positive effects of supplementing diets with polyunsaturated essential fatty acids on reproductive performance in farm animals. Fish oil contains EPA and DHA as omega-3 fatty acids and plays a major role in the production of eicosanoids. On the other hand, plant oils rich in omega-6 fatty acids such as linoleic acid have been reported to improve immune status of animals. The positive effects of fat and energy supplementation on the improvements of reproduction in dairy cows are well documented, but the specific effects of omega polyunsaturated fatty acids (n-3 and n-6) on reproductive success in small ruminants have not been examined in detail. While the link between n-3 fatty acids and reproductive markers such as (PGF2α) are well established, evidences for direct effects of high n-3 fatty acids supplementation on measurable reproductive outcomes in ruminants is limited. There is little information regarding the effect of dietary energy level and energy source on reproductive activity in Iranian fat-tailed lambs.This study was carried out to determine the effects of increasing dietary energy level by carbohydrate or fat supplementation using rumen-protected calcium salts of fish oil as omega-3 fatty acid sources or soybean oil as omega-6 fatty acids on ovarian activity and some blood parameters in Ghezel ewes.

    Materials and methods

    Twelve Ghezel ewes were assigned into four groups with three animals based on a  completely randomized design. Diets were formulated according to small ruminant’s nutrient requirement using Small ruminant nutrition system (SRNS, Texas A&M University, version 1.11.7154.28131). The control group received maintenance energy requirements. While the second experimental groups received a diet with  20% extra energy supplied by barley grain. Calcium salt of fatty acids rich in Omega-3 fatty acids (eicosapentaenoic and docosahexaenoic acid) and Omega-6 (linoleic acid) were partly replaced with barley grain in third and fourth experimental groups, respectively. The estrous cycle of the ewes was synchronized with two consecutive injections of prostaglandin. Ultrasound examination of the ovaries started after second PG injection and continued for three estrous cycles. Through the first cycle, all of the animals received the control diet. Experimental diets were fed through the second and third estrous cycles. The first cycle for each of the experimental groups was considered as the control for study the effects of different dietary treatments. Blood sampling was done on day 12 of the luteal phase of each experimental cycles, four hours after the morning meal and plasma and serum were analyzed for energy-related parameters such as glucose, triacylglycerol’s, insulin, non-esterified fatty acids, beta-hydroxybutyric acid as well as sex hormones.

    Results and discussion

    Plasma levels of glucose, triacylglycerol’s, non-esterified fatty acids, beta-hydroxybutyric acid, and serum levels of estrogen and progesterone were affected by energy levels in the diet. However, effects of energy source were also significant in the case of glucose, BHBA and hormones levels. Concentrations of glucose, triacylglycerol, HDL, total protein, albumin, urea VLDL, estrogen, and progesterone (P<0.05) were affected by the experimental treatments and increased with increasing energy levels. The type of energy source (carbohydrate versus fat) showed a significant difference in concentrations of glucose, cholesterol, VLDL, globulin, estrogen, and progesterone (P<0.05). The highest plasma glucose concentration was in the barley-receiving group. Increasing the dietary energy level resulted in improvement of various energy indices such as the concentration of non-esterified fatty acids and beta-hydroxybutyrate (P<0.05). Triacylglycerol and HDL concentrations were not significantly different between ewes consuming different energy sources, but increased with increasing dietary energy levels. Supplementing the diet with protected poly-unsaturated fatty acids has resulted in higher plasma unsaturated fatty acids. In this case, energy levels, energy source, and lipid supplementation type exert significant effects. The use of linoleic acid supplementation in this study increased arachidonic acid concentration (P <0.05). Twenty-carbon unsaturated fatty acids are a direct precursor of a large group of active compounds called eicosanoids, including prostaglandins, thromboxanes, leukotrienes, and lipoxanes. Omega-6 fatty acid supplemented diet increased ovulatory follicle diameter in the third cycle of the experiment compared with control cycle. However, omega-3 supplementation decreased it. On the other hand, the follicular waves counts were not influenced.

    Conclusion

    Results showed that higher energy content or even the energy source could not significantly affect the various parameters of the estrous cycle such as follicular waves count, length of the estrous cycle, follicular diameter, and the number of ovulation in each cycle (P>0.05). Nevertheless, the change in energy level and the source had been exerted significant effects on plasma fatty acids profile and energy-related metabolites (P<0.05). This study was performed in the reproductive season with the limited number of animals and it seems  that normal body condition of experimental animals, as well as long term dietary inclusion of high energy supplements, have potentials for affecting  the results. Further examination in reproductive and non-reproductive seasons with more replications and also, investigation of the effects of different energy sources and energy levels on reproductive performance could be suggested.

    Keywords: Omega3, Omega6, Ovarian activity, Ultrasonography
  • MT Karimi, R Valizadeh *, AA Naserian Pages 43-59
    Introduction

    In livestock rearing, providing a balanced diet for animal in order to produce meat and milk is the main component of this profession. Due to the limited rainfall and lack of good forage resources in Iran, nutrition has the highest cost share in livestock production. Therefore, identifying local source of animal feed and determining their nutritional value is essential. Because using these local feed sources in addition to reducing feed costs, prevents the depletion of these natural resources and increases employment. Reed fodder is one of the available forage species in many parts of the world, including Iran, and has a good potential for using in livestock feeds. This plant grows abundantly in wetlands and on the banks of most rivers in the country. Despite the severe shortage of livestock feed in Iran, the reed fodder is not used properly in livestock feeds. The crude protein, crude fiber and calcium amounts of reed fodder are 11.4%, 31% and 0.17 %, respectively. A cow weighing 300 kg needs 6 %digestible protein for 500 g daily gain, which reed fodder can supply half of the digestible protein and all the calcium and phosphate. The expansion of the livestock feed industry made it perfect feed for the various stages of growth of the most types of livestock. Complete feed block (CFB) is composed of forage, concentrate, and other supplementary nutrients in a desired proportion, which is capable to fulfill nutrient requirements of animals. The feeding of CFB stabilizes rumen fermentation, minimizes fermentation loss, and ensures better ammonia utilization. Advantages of CFB are using local feed raw materials which are cheaper and easier in distribution, because the distance between the processing place and the farm is closer. Also, it has a competitive advantage compared with commercial feed manufactured in large industrial scale; because, it is more efficient in production, it is lower in transportation costs and easier in storage, and it can reduce operating costs, especially labor. The type of feed will prevent selective feeding of animals;then, nutrients are provided more evenly by rumen microorganisms. There are few studies on the use of reed fodder in complete feed block form. Therefore, the main objective of this study was to evaluate the effects of diet containing reed fodder (Phragmatis australis) in the form of complete feed block on growth performance of Baluchi lambs.

    Material and methods

    Thirty male lambs with an average age of 5 to 6 months and weight of 28±2.9 kg were fed with complete diets based on 30% forage and 70% concentrate. The experimental diets were: 1) total mixed ration containing alfalfa hay and wheat straw as the control, 2) complete feed block containing reed fodder as block diet, and 3) total mixed ration containing reed fodder as mixed diet. The experiment was conducted in a completely randomized design with three treatments and 10 replications. Animals were fed the experimental diets for 105 days, and daily feed intake were recorded. A digestion trail for seven days were conducted at the middle of experimental feeding, and daily feed intake and feces excretion were recorded. At the end of experiment, rumen fluid samples were taken from each animal at 3 h after morning feeding. Concentration of NH3-N was determined for rumen fluid samples according to Broderich and Kang (1980), and VFA were analyzed according to Ervin et al. (1961). Rumen fluid was used to direct count of protozoa using the methods of Dehority (2003). The chewing activities were recorded through a visual observation method for a period of 24 h continuously (08:00 to 08:00 the next day) at 5 – min intervals. Blood samples from jugular vein were collected in serum tubes containing anticoagulant agent approximately 4 h after morning feeding.

    Results and discussion

    Feed intake (g/day), weight gain (g/day), and final weight (kg) of lambs fed with control and block diets were higher than those fed with mixed diets (P˂0.05). Apparent digestibility of DM, NDF, ADF, and CP in lambs fed with control and block diets were higher (P˂0.05), but no significant difference was observed between lambs fed with control and block diets. In lambs receiving the mixed diet, the NH3-N concentration was lower and the ratio of acetate to propionate was higher (P˂0.05), but no significant difference was observed between lambs receiving the control and block diets. The pH of rumen fluid as well as concentrations of isovaleric acid and valeric acid were not affected by experimental treatments. The whole rumen protozoa population and the population of Entodiniums and Epidiniums were higher in lambs fed with block diet (P˂0.05), but no significant difference was observed between lambs fed with the control and mixed diets. The concentration of blood urea nitrogen (BUN) was lower in lambs fed with the control and block diets (P˂0.05), but no significant difference was observed between lambs fed with the control and block diets. Other blood metabolites were not affected by experimental diets. The physical form of the feed (block diet) significantly increased the eating rate, ruminating rate, and total activity of the chewing (P˂0.05). Compared to lambs fed with block and mixed diets, lambs fed with control diet spent more time for eating, ruminating, and chewing. Feed conversion ratio of lambs fed with diets containing reed fodder was not affected by the physical form of the feed. Probably the decrease in air temperature during the fattening period affected the feed conversion ratio, and it was more effective for lambs fed with mixed diet with rough feed. The cost of feed per kilogram of live weight gain during the fattening period for each of the control, block, and mixed diets was calculated as 76630, 66360 and 67270 Rials, respectively. Based on these results, the use of reed fodder in the form of cubic blocks was more economical than the other two treatments.

    Conclusion

    The results of this experiment support the positive effects of using diets containing reed fodder in the form of complete feed block with the lower costs in areas which have the potential for growth of reed fodder.

    Keywords: Baluchi lamb, Complete feed block, Chewing, Protozoa Reed fodder
  • N Rastidoust, S Nikbin *, B Navidshad, Gh Elyasi Pages 61-70
    Introduction

    Neuropeptide Y (NPY) is a neurotransmitter that presents at high concentrations in the hypothalamus. Neuropeptide Y is one of the most abundant peptides in chicken's brain, which works as a neurotransmitter in many functions and behaviors. The first time, it was extracted from the pituitary hypothalamus of pigs. This neuropeptide stimulates appetite and affects reproductive hormones. It was showed that there is a significant association between NPY gene and growth and reproductive traits of animals. The aim of this study was to investigate NPY gene polymorphisms and their association with reproductive traits in indigenous turkeys of Iran. These traits were including total egg weight production, length of laying period, age at the first egg, and the weight of the first egg.

    Materials and methods

    A hundred and twenty turkey hens were randomly chosen from turkey’s breeding center of East Azerbaijan of Iran. They were recorded for the reproductive traits. The blood samples of the birds were taken from their wing veins and used for DNA extraction. DNA was isolated from each animal's blood samples using salting-out method (Miller et al 1999).A fragment of 725bp of NPY gene was amplified using designed specific primers. The forward and reversed primers were GAAGCGTACCCCTCCAAAC and CCCCTTTAAGCAGCACAGTC, respectively. PCR was performed in a final volume of 25 ml containing 2ml of DNA template, 1.2 ml of each primer, 8.1 ml water and 12.5 ml master mix containing: dNTP, proofreading Taq polymerase, MgCl2, and 1x PCR buffer. Thereafter, the PCR was programmed as follows: an initial denaturation step at 94°C for 5 min, followed by 32 cycles of 94°C for 60 s, 56° C for 40 s, and 72°C for 45 s. A final extension step was performed at 72°C for 8 min. Electrophoresis of the amplicons was carried out on 1.5% agarose gels, and the gels were visualized under ultraviolet light after 45 minutes in 85 Volt. It should be noted that PCR products were purified and sequenced by Bioneer Company. The polymorphisms of the NPY gene was identified by commercially sequencing the PCR products and aligning the sequences using BioEdit software. PopGen32 software was used to identify genotype and allele frequencies. The associations of polymorphisms or haplotypes with the traits were analyzed using the SAS GLM procedure. Multiple comparisons of Tukey’s test were performed to find differences among means.

    Results and discussion

    The results revealed four novel SNPs in the NPY gene, which has not been already reported in turkey. The detected polymorphisms were including T360G, C367A, T544A, and C552T. Results of statistical analysis showed that there was a significant association between T360G and total egg weight. The T allele was the favorable allele for total egg weight trait as the TT genotype significantly increased the weight of produced eggs. The polymorphism of A544T was significantly associated with egg weight and laying length. The AA genotype of A544T positively influenced both egg weight and laying length traits.  Both SNPs were located in the intron region of the gene. Although intronic mutations are not capable of altering the synthesized protein structure and/or changing the function of the protein, they may affect the level of gene transcription. Additionally, it was proved that the intronic polymorphisms may affect the gene expression levels via influencing the splicing process. Several studies have already been revealed that the NPY gene polymorphism, especially on the promoter and 5'-UTR regions, affect the reproductive traits of chicken. There is another study that reported a significant association between the SNPs of intron 3 of the NPY gene with growth and body traits in cows. It has been proven that NPY neuron terminals directly end on GnRH neurons and NPY is synthesized prior to the release of GnRH. It then releases the follicular stimulating hormone (FSH) and the luteinizing hormone (LH) from the pituitary gland. It has been shown that NPY influences GnRH secretion via affecting Kisspeptin neurons, which consequently alter reproductive traits. Also, stimulating the secretion of the GnRH through the neuropeptide receptors can lead to early maturity in the chicken. On the other hand, it was revealed that stimulation of NPY neurons mediates an increase in energy intake and storage. Altering the NPY gene expression in the hypothalamus of birds resulted in changing energy status. Moreover, NPY has been shown to be a potent appetite stimulating agent in chickens. Specific NPY receptors (Y1 and Y5) have been reported to mediate NPY effects on feeding behavior in chickens. In order to continue laying eggs, turkey hens need a higher amount of available energy and nutrients. Investigations in humans also represented that polymorphisms in NPY influenced fatness in men and was linked to body weight, BMI, body fat prototype, and leptin levels (Ding 2005, Van 2006). Concentrations of NPY are prominent when body fat reservoirs are fully consumed, resulting in hunger enlargement (Kalra et al. 1991). Consequently, upon negative energy balance, NPY levels are anticipated to be elevated. In addition, NPY has been recognized as a major controller of leptin action in the hypothalamus, affecting the discharge of LH and somatotropin (Kalra et al. 1991). This study has pointed out considerable relationships among leptin and NPY SNP with vital intensification, fertility, and milk production characteristics (Clempson et al. 2010). Also, it is assumed to be the cause of augmenting body mass index (BMI) in two different Swedish statistical groups of normal and fat peoples (Ding et al. 2005). The -880I/D advocate region variant of NPY might impact body fat prototyping in non-obese Mexican Americans from Starr County (Bray et al 2000). Therefore, effect of NPY on appetite may influence the supply of nutrients and energy to be consumed for reproductive performance specially egg production traits.

    Conclusion

    In conclusion, four novel polymorphisms were detected in intron 1 of Meleagrine NPY gene. The polymorphisms of the NPY gene may affect some of egg production traits. If these effects validate by investigating them in a larger or another turkey population, they can be considered in breeding programs of native turkey population in North-West of Iran.

    Keywords: Egg weight, Laying, Period, NPY, SNP, Turkey
  • T Talebi, J Seifdavati *, S Seifzadeh, F Mirzaei, H Abdi Benmar, R Seid Sharifi Pages 71-86
    Introduction

    Between 2 to 12% of a ruminant’s energy intake is typically lost through the enteric fermentation process. Ruminant production is associated with nitrogen loss especially in the form of ammonia from urine and manure management during composting. These contribute to greenhouse emission and environmental pollution in general. In the past few decades, feed additives such as antibiotics, ionophores, methane inhibitors, and anti-protozoa agents have been successfully used to reduce these rumen energy, nitrogen releases and metabolic disorders (Calsamiglia et al. 2007), though   increase production efficiency. Therefore, ruminants’ nutritionists try to use compounds that increase the efficiency of energy and protein intake by changing the population and activity of ruminal microorganisms (Fereydounpour et al. 2016).   These alternative compounds are probiotics, organic acids, and medicinal plants (Calsamiglia et al. 2007). The essential oils are secondary plant metabolites, which have antimicrobial properties and can be suitable substitutes for antibiotics to alter rumen microbial activity. Also, a research has shown that the essential oils and their constituents have the potential to improve nitrogen and energy utilization in ruminants (Patra et al. 2006). Talebzadeh et al (2012) reported that the essential oil of thyme at 150, 300, 450, and 600 micrograms per ml of culture medium was used only at concentrations above 450 mg decreased the real digestibility of organic matter. Adding powdered herbs such as thyme and garlic cabbage can affect the in vitro digestibility and the amount of in vitro gas production in sainfoin and alfalfa and their mixture. Thymol is a main phenolic component in thyme and carvacrol is also a minor component (Leung and Foster 1996). These compounds are involved in oxidation and reduction reactions. Thyroid has a large antimicrobial activity by preventing the bacteria growth. Researchers reported that active compounds in garlic containing allycine, diallylsulfide, and di-allylene sulfide, which can affect ruminal harmful bacteria. Considering the various compounds and effects of thyme and garlic and the need for further studies on medicinal plants, this study carried out to investigate the effects of adding levels of thyme powder and garlic on digestibility and fermentation parameters of sainfoin and alfalfa forage in laboratory conditions.

    Material and methods

    A study was conducted to investigate the effect of adding different levels   of thyme powder and garlic cabbage powder on digestibility and the amount of in vitro gas production at three levels of 0, 1.5, and 3% for alfalfa, sainfoin and mixed alfalfa and sainfoin based on a completely randomized design. Measurement of digestibility of alfalfa forage, sainfoin and mixture of 50% alfalfa and 50% sainfoin were carried out using thyme powder and garlic cabbage powder by Holden method (2000). In this method, the nylon bag was used instead of filtration and a daisy (rumen simulator) incubator was used instead of a hot water bath. Menke et al (1979) method was used to measure the amount of gas production. The amounts of short chain fatty acids, digestibility of dry matter, organic matter in dry matter, and metabolizable energy were estimated using related equations (Menke and Steinggass 1988). The data obtained from the method of gas production analyzed in a completely randomized design with repeated measurements. Data digestibility by Holden was investigated in a completely randomized design using SAS (2003) software.

    Results and discussion

    The results showed that adding 1.5% thyme and garlic to sainfoin forage improved digestibility of dry matter, organic matter digestibility, digestibility of organic matter in dry matter, and metabolizable energy compared with control group (P <0.05). Also, adding 3% garlic powder showed a significant increase in digestibility of organic matter in dry matter and metabolizable energy compared with the control group (P <0.05). But adding 1.5% and 3% thyme and garlic powder to alfalfa and mixed alfalfa and sainfoin had not a significant effect on dry matter digestibility, organic matter digestibility, digestibility of organic matter in dry matter and metabolizable energy compared with the control group. The results showed that adding 1.5 percent of garlic powder to sainfoin was reduced the amount of produced gas compared with the control group for 6, 24, 48 hours after incubation and also adding 3 percent of garlic powder to sainfoin was decreased the amount of produced gas compared with the control group for 6, 24, 48, 72, 96 and 120 hours after incubation (P <0.05). This trend was followed by the reduction of the amount of gas for treatment of 3% garlic + alfalfa at 3, 6, 12, 24, 48, 72, 120 times compared with the control group (P <0.05). Feeding 1.5% of garlic powder was increased the amount of produced gas at 3, 48, 72, and 120 hours of incubation compared with the control group (P <0.05). The results showed that adding 1.5 and 3% garlic powder to sainfoin forage had the lowest amount of digestible organic matter, short chain fatty acid, metabolizable energy, gas production potential and gas production rate compared with other treatments (P <0.05). Also, results showed that 3% of garlic powder in alfalfa had the lowest amount of digestible organic matter, short chain fatty acid, metabolizable energy, gas production potential compared with the control group (P <0.05). Adding plant additives had no significant effect on mixed of alfalfa and sainfoin compared with the control group. The essential oils that contain high levels of effective components (Fraser et al. 2007) or even low ones (Castillejos et al. 2006) can affect digestibility. This is due to the sensitivity of fibrolytic bacteria to the active components of all essential oils (Benchaar et al. 2007).

    Conclusion

    The effect of different levels of thyme and garlic on the nutritional value and digestibility of forage and sainfoin showed that addition of 1.5% of garlic and thyme improved the digestibility of forage by Holden method. Generally, adding thyme to forage at most of the times did not significantly improve the amount of gas produced compared with the control group, but at some times there was a numerical increase in the amount of produced gas. Adding 3% garlic at most of the times and 1.5% garlic at some of the times caused a significant reduction in the amount of produced gas compared with the control group. It can also be concluded that the use of 3% garlic reduced the fermentation parameters obtained from the gas test (total volatile fatty acid, metabolizable energy, and digestibility) in sainfoin and alfalfa. The results of this study suggest that the addition of thyme and garlic can change the fermentation parameters and the amount of gas production, which is different depending on their usage amount.

    Keywords: Alfalfa, Digestibility, Garlic, Metabolizable energy, Sainfoin, Thyme
  • S Khalaji* Pages 87-104
    Introduction

    The prevalence of antibiotic resistant pathogens has resulted from the use of sub-therapeutic concentrations of antibiotics delivered in poultry feed (Sandra Diaz-Sanchez etal. 2015). The ban on the use of antibiotic feed additives as growth promoters caused researchers for exploring the future utility of other alternatives (Hamid etal. 2018). Furthermore, there are a number of consumer concerns regarding the use of antibiotics in food animals including residue contamination of poultry products and antibiotic resistant bacterial pathogens. These issues have resulted in recommendations of reducing the use of antibiotics as growth promoters in livestock around the world (Sandra Diaz-Sanchez etal. 2015). Now a days conventional and organic productions have been limited to use antibiotics. Thus, both conventional and organic poultry production need alternative methods to improve growth and performance of poultry. Organic acids, herbs, spices, and various other plant extracts are being evaluated as alternatives to antibiotics and some do have growth promoting effects, antimicrobial properties, and other health-related benefits (Sandra Diaz-Sanchez etal. 2015 and Hamid etal. 2018). Current study was designed for further elucidation of the effects of the organic acid combined with phytogenic plant on gut healt in chicks fed with mash or pellet diets, therforecurrent trial was conducted to evaluate the effects of Phytocid (a plant-organic acid complex) on performance, immune response, and gut health of broiler chicks.

    Material and methods

    Experiment was done as a completely randomized design with 8 treatments (4 mash and 4 in pellet form), 4 replicates of 7 chicks in each pen. Treatments included control, control+1 or 2 g/kg Phytocid and control+ Salinomycin (0.5g/kg). Two basal diets were formulated for starter (1 to 21) and grower (22 to 42) period and Phytocid (1 and 2g/kg) and Salinomycin were added to the basal diet. For each treatment, a batch of 100 kg of each ration was mixed by using a Twin-Shaft Paddle Mixer and batches of the resulting ratins then were divided into two portion. The first portion was fed in mash form and the second portion was pelleted. The birds were reared in floor pens having wood shavings as litter material over a concrete floor. The room temperature was thermostatically set by automation systems using the two heaters and one fogger. Bell drinkers from the same polyethylene tank were used and water was provided ad libitum. Body weight and cumulative feed intake were measured on d 7, 21, and 42 for each pen and the feed conversion ratio (FCR) was calculated. Antibody titer aginst Newcastel and and Avian Influenza were measured at 36 d of age. Plasma triglyceride, cholesterol, LDL, VLDL, HDL, heamatocrit, and heamaglobin concentration was measured at 42 d of age. Gastrointestinal pH was measured at 42 d of age. On d 7 and 21, two chicks from each pen were slaughtered by neck cutting for extraction of cecal contents. The cecal contents of each bird were pooled for serial dilution. Microbial populations were determined by serial dilution (10−4 to 10−6) of cecal samples in anaerobic diluents before inoculation onto petri dishes of sterile agar as described by Bryant and Burkey (1953). Salmonella was grown on Salmonella Shigella agar (Merck, Germany) and Coliforms were grown on McConkey agar (Darmstadt, Germany). Plates were counted between 24 and 48 h after inoculation. Colony forming units were defined as distinct colonies measuring at least one mm in diameter. On d 42, a 2-cm segment of the middle of the ileum was washed in physiological saline solution and fixed in 10% buffered formalin and formalin was changed three times for fixation. A single 0.5-cm sample was cut from each ileal section, dehydrated using increasing ethanol concentrations, cleared with xylene, and placed into polyfin embedding wax. Tissue sections (2 µm) were cut by microtome (model; Easy cut 202, Italy), floated onto slides, and stained with hematoxylin (Gill number 2; Sigma, St. Louis, MO) and eosin (Sigma Aldrich, Darmstadt, Germany). For each sample, villus height and crypt depth were measured using a digital camera that had light microscopy (Motic-SMZ-140, Germany). Twenty-five images from 15 tissue sections of each ileal section were taken and villus heights and crypt depths were measured by imaging software.

    Results and discussion

    Supplementing diet with Phytocid increased body weight gain, feed intake, and reduced feed conversion ratio significantly throughout the experimental period (P<0.05). Phytocid did reduce ileum and jejenum pH significantly (P<0.01). Supplementation of pellet and also mash diets with Phytocid did decrease Salmonella, coliform, and E-Coli population of ileum and ceca at 7 and 21 d of age significantly (P<0.05). Ileal villus length and crypt depth was increased by addition of Phytocid to basal diets.

    Conclusions

    Results of current trial showed that Phytocid have beneficial effect on gastrointestinal health and improved weight gain and feed intake and feed conversion ratio in broiler chickens and could be a possible replacing agent to antibiotics in poultry.

    Keywords: Formic acid, Gut health, Mentha pulegium, Nigella sativa seeds
  • SA Rafat, H Karimi *, J Shodja, F Balazadeh Pages 105-118
    Introduction

    Cashmere is a very fine fiber that is produced by secondary hair follicles in cashmere goat. Based on American test and material association description, cashmere is fine fiber in Asian Indian goat hair follicles with diameter lower than 30 microns. Cashmere is growing as “under coat” in cold season and it shedds during the time from late winter until early spring. It is estimated that 68 goat breeds produce cashmere fibers in the world. Cashmere goats are originated from Asia. The important countries that can produce a large amount of cashmere are China, Mongolia, Iran, Turkey, and India. Total production of cashmere is estimated to be 5mt. During the last decades, due to the economic importance of cashmere, USA, Australia, and NewZealand joined to the cashmere producing countries. Many researchers reported that cold climate is suitable for production of quality cashmere. In this research, effects of nutrition and age on histological characteristics of Raeini Cashmere goat were studied in Tabriz, East Azerbaijan.

    Material and methods

    For this research, 24 female Raeini cashmere goats were selected. The goats were selected from Baft Raeini cashmere goat breeding and husbandry station. Goats were fed individually   and were treated for 8 months of study based on feeding levels (Maintenance, 0.7 M, 1.4 M, and 1.8M) and age (6 months and 18 months) on fleece growth. The trial was conducted at the khalat-Pushan Research Station, University of Tabriz. The goats allocated to four feeding levels: M (goats fed to maintain live weight, 0.7M (goats fed to lose 3Kg live weight from February to September), 1.4M, and 1.8M (goats fed to gain live weight). Patches of fleece from defined areas were repeatedly shorn at 4 weekly intervals from the right mid side of each goat. For follicle study, in the fist, 120cm2 of left side of animals was marked firstly; then, these region fibers shaved by electrical shaver. Shaving was repeated monthly (for four weeks). Skin biopsy was taken monthly from left mid side of skin of abdomen. samples were fixed in 10% formalin. Paraffinized block were prepared and then, they are sectioned as serial section in 8-micron thickness. Histological sections were stained by sak pic method (reference ????). Results were analyzed by analyses variance and paired t-test.   

    Results and discussion

    This research results, showed that there was no significant effect of feeding level or age on weight of cashmere and hair per area, secondary follicle activity, cashmere length, and yield (P<0.05). Fleece and live weight for young goats were significantly less than that of old goats (P<0.05). Result were appeared that mean cashmere diameters of patch shorn in September of goats fed M, 1.4M and 1.8M were significantly greater than that of goats fed 0.7M (P<0.05). In group feeding more than maintenance requirements, results indicated no increase in cashmere production. Average fiber diameter of cashmere in June was higher than in May. Results of this research indicated that there are not any significant differences between different levels of feeding and age on fiber growth rate (P<0.05). The highest fiber production and the maximum mean of fiber growth rates (1.64 and 1.48 g/120cm2 / 28 days) were observed in June and July. Secondary to primary follicle ratio of all goats was 12.60. Study of secondary follicles ratio showed that different levels of feeding cannot reduce number of secondary follicles. Many researchers reported that increase in feeding levels to over maintenance rate cannot increase cashmere growth rate. This research results confirmed by previous studies. it was reported that feeding limitation can reduce diameter of cashmere, but there is not any increasable effect during over maintenance feeding and an increase in dietary protein. This research indicated that cashmere diameter was more in two-years old goat than one-year old goat cashmere diameter. These   results were similar with reports of Klor et al. (1993), Rafat (1997), and Salehi (1997). Increase in diameter of wool fibers with increasing in the age of animals was reported in sheep and goat. In other studies, it is shown that effect of age on diameter of Norway cashmere goats was significant (P<0.05). Results of our research show that diameter of cashmere in Raeini goats increases at June. Similar results are illustrated in Kerman (with the same age and sex). The weight of produced fibers / body surface was the same in four feeding treatment groups, but diameter of cashmere was different. Numbers of secondary follicles   increased in April. Minimum weight of fibers was observed in April in all of the treatments, which may be because of low activity of follicles in this month. Variation of cashmere diameter and cashmere growth rate can explain differences in total cashmere production. Changes of feeding level from under maintenance to high levels cause increase in cashmere diameter. This study appeared that diameter of cashmere fibers can have reaction to feeding rate. Accordingly, energy has important effect on growth of hair and cashmere. The animals with low energy diet produce low amount of cashmere, Other researchers have opposite idea. According to their statement, there are not any difference in partition for nutrient between primary and secondary follicles. This research result showed that increase feeding cannot increase cashmere production. Jia et al (1995) reported that increase of diet net protein has not any important effect on cashmere goats production in Spain. In other study using unpregnant goat it has been indicated follicular activity and fiber growth is not under influence of pregnancy and milking. However, some researches showed that reproduction condition of animal, as pregnancy and milking, has effect on cashmere fiber growth.  

    Conclusion

    Generally, results of this study showed Raeini cashmere goats in East – Azarbayjan climate did not show any fundamental changes in diameter and length of cashmere in comparison with Raeini cashmere goats which reared in Kerman province.

    Keywords: Age, Fibers, Cashmere Raeini goat, Nutrition
  • G Taherparvar, AR Seidavi *, L Asadpour, R Payan Carreira Pages 119-132
    Introduction

     Poultry litter is composed of bedding material, excreta, feed, feathers and water. It is currently accepted that litter quality can add to environmental and management problems in the commercial poultry industry. Several studies are available on the impact of litter material or quality on the intestinal health immunity of poultry, but often they focus on particular pathogens, potentially detrimental to humans or other livestock, or on imposed limitations to broilers performance. 

    Aim

     This study aimed to assess whether the type of bedding materials (sand, wood shaving, and paper) or chemical amendments (lime and bentonite vs. controls) affect blood parameters and immunity of broiler chickens. 

    Materials and methods

     Two hundred and seventy male Ross broiler chickens were randomly assigned into nine treatment groups with three replicates per each treatment (a total of 30 birds per each treatment). A completely randomized 3 × 3 design was used, with the main effects of bedding materials/subtracts (sand, wood shaving, or paper) and amendments (no amendment (control), bentonite, or lime), in three replicate pens of 10 chicks each, in a total of 27 experimental units. Starting at day one, groups were created according to the combination of beddings and amendments, as follows: Group 1 (Grp 1) - control sand bedding; Group 2 (Grp 2) - sand bedding treated with Bentonite; Group 3 (Grp 3) - sand bedding treated with lime; Group 4 (Grp 4) - control wood shaving bedding; Group 5 (Grp 5) - wood shaving bedding treated with Bentonite; Group 6 (Grp 6) - wood shaving treated with lime; Group 7 (Grp 7) - control paper bedding; Group 8 (Grp 8) - paper bedding treated with Bentonite; and Group 9 (Grp 9) - paper treated with lime. 

    Results

     The results showed that different bedding materials (sand, wood shavings, and paper) had not effect on most analyzed traits; though, we detected a small significant increase in the influenza antibody titres at day 36 (P < 0.05) in sand reared groups, and an increase in the total immunoglobulins (Ig) titres (due to increased IgM) on 14 days after challenged with sheep red blood cells (P < 0.05). Treatment of the bedding material with Bentonite or lime mainly affected the humoral immunity traits assessed herein. Lime treatments slightly increased the antibody titres for Influenza at the first challenge, but did not affect them on the second challenge. In contrast, no treatments increased total Ig titres (due to an increase in IgM) at day 38. The comparison of the nine groups (bedding type × amendment) indicated small differences in particular blood parameters and the humoral immunity traits. 

    Conclusion

     Although, no deleterious effects were found on broilers, the results suggested that different litter materials with distinct amendments may affect the final quality of carcasses.

    Keywords: Bedding material, Broilers, Chemical supplementation, treatment, Immune system, Litterquality, Microbiota