فصلنامه تحقیقات تولیدات دامی
سال سیزدهم شماره 3 (پاییز 1403)

Gene regulation can be assessed by allele-specific expression (ASE), which has the potential to cause phenotypic variation. The variants associated with gene regulation can be found using ASE. Transcriptomic variation in gene expression is known to play an important role in the formation of the phenotype. Single base variations resulting from transitions (C/T or G/A) or transversions (C/G, C/A, T/A, T/G) of nucleotides at the same position between individual nucleotides in genomic DNA sequences are known as single nucleotide polymorphisms (SNPs). SNPs are important molecular markers used in breeding and genetic research. Next-generation sequencing is advancing rapidly and provides a high-throughput approach for SNP discovery in the transcriptome or genome. Transcriptome studies can bridge the gaps between genotypes and phenotypes and provide insights into the mechanisms linking sequence and function. An effective transcriptome mapping and quantification technique for studying global gene expression is RNA sequencing or RNA-Seq. For this reason, RNA-Seq is a next-generation sequencing technology that can analyze gene expression profiles and the entire transcriptome. This study aimed to identify differential gene expression and SNPs in three tissues of the heart, muscle, and spleen of roosters adapted to low and high altitude regions based on open access RNA-Seq databases.

RNA-Seq data from 54 samples were collected from the SRA database in NCBI for chickens (NCBI GEO accession: GSE119387). The samples included 33.4, 30.3, and 35.3 million paired final reads of heart, muscle, and spleen tissues, each 100 bp in length. Illumina Hiseq 2000 was used to perform mRNA sequencing. The fastq-dump command in Sratoolkit 2.11 was used to convert data from SRA to FASTQ format  FastQC (version 0.11) was used to assess data quality and Trimmomatic (version 0.33) was used to trim the reads to eliminate adapters and low-quality sequences. Trimmed reads were aligned to the reference genome of the chicken species (Gallus gallus domesticus) and the gene annotation data (GRC6a) from Tophat2, whose core host is Bowtie2. By independently aligning and mapping the RNA-Seq reads of each sample to the chicken reference genome, the transcriptome was assembled. Then, the differential gene expression analysis was performed with cufflinks. The Samtools program performed SNP detection. Finally, using the R software (version 4.2.2), the chi-square test was used to compare the amount of expressed reference and alternative alleles in the polymorphic regions of heterozygous individuals to find the notable variations.

As a result of gene expression analysis, 2260 genes were significantly differential expression (P<0.0002). Gene ontology analysis showed that these genes are in pathways related to heat stress and immune responses to the cause of trying to maintain body temperature involved and this cause was the activation of immune pathways. Identification of 1,473,176, 388,224, and 1,169,394 SNPs in the heart, muscle, and spleen tissues was enabled by SNP calling and discovery in the assembled transcriptome. The chi-square test revealed that the ASE-SNPs in the heart, muscle, and spleen tissues were 48,906 (10.3%), 28,529 (7.3%), and 76,251 (6.3%) SNPs (P<0.05). These SNPs were associated with 7,919, 6,182, and 10,590 genes in the heart, muscle, and spleen tissues. In three tissues, the number of reference and alternative alleles was shifted by 4.5% in favor of the reference allele. This suggests that the superiority of the reference allele over the reference genome during mapping may be related to mapping bias. Among the twelve potential SNPs and ASE-SNP types found, four were transition types (Ts) and eight were transformation types (Tv). The transition type accounted for 74% of the most common polymorphisms in the heart and 77% in the muscle and spleen. For ASE-SNPs, transition mutations accounted for 70% of all mutations in the heart tissue and 75% in the muscle and spleen tissue. These mutations were also the most common. The Ts/Tv ratios for the heart, muscle, and spleen tissues were 2.3, 3, and 3 in the ASE-SNP and 2.9, 3.3, and 2.2 in all SNPs, respectively. This indicated a decrease in Ts/Tv for the heart and muscle tissues in the ASE-SNP compared to all SNPs.

The results of the current study support the validity of identifying SNPs in transcriptionally active regions of the genome using RNA-Seq data. Further research is needed to determine whether the expression differences between reference and alternative alleles found in heterozygous roosters raised in different environments are related to tolerance to environmental stressors such as low oxygen levels.

The sex of chickens considerably impacts production performance and economic benefits in poultry farming. Male birds cannot lay eggs and usually have a lower ratio of meat to feed than broilers. Male chicks are typically killed immediately after hatching since they are redundant in the industry and male chicks will neither be suitable for egg production nor meat production. Day-old male chicks in the laying hen industry are usually culled immediately after hatching. As a result, this issue has caused moral concerns in societies. Efforts are underway to develop technology for automatically determining the sex of chick embryos, aimed at establishing a stable and efficient poultry farming system. In large commercial hatcheries, the sexing of newly born chicks is generally accomplished by three different methods according to new hatching lines' vent, color, or feathers. However, these methods are still time- and labor-consuming. If sex can be identified at an early embryonic stage or even before incubation, male eggs could be used as feed components. Moreover, fewer eggs would need to be incubated, which would reduce feed space requirements, CO2 emissions, and energy consumption, which are all economically beneficial to farmers and the environment. In recent decades, researchers have used various in ovo sexing strategies in chicken eggs before hatching or incubation. Some invasive and noninvasive studies that have been conducted for in ovo sexing of chicken eggs can be divided into five major categories: (i) molecular-based techniques, (ii) spectral-based techniques (Raman spectroscopy, fluorescent, 3D X-ray), (iii) acoustic-based techniques, (iv) morphology-based techniques, and (v) volatile organic compound (VOC)-based techniques. Commercially applicable methods must be noninvasive, rapid enough for real-time applications, economically feasible, and ethically acceptable. An alternative method, to prevent the removal of day-old chicks, is a non-invasive method to determine the sex of the egg in the early stages of hatching before the development of the nervous system. Recently, Raman spectroscopy was reported to determine the sex of eggs at the incubation stage. Raman spectroscopy is based on the Raman effect, whereby when incident light (wavelength 750–850 nm) excites molecules in a tissue, the molecules reflect light at a different wavelength. The reflected light's wavelength is characteristic of various chemical components and allows the detection of the atheromatous plaque chemical synthesis. Raman spectroscopy is a powerful tool expected to revolutionize chick sex determination because it can provide information about biological molecules. Thus, Raman spectroscopy is suitable for analyzing living organisms, leading to its widespread adoption across various biological and medical applications. Therefore, resonance Raman spectroscopies have found application in blood analysis, with some studies exploring its utility in chick sexing. For this purpose, the present study was carried out to investigate the feasibility of determining the sex of Iranian native chicken embryos using the Raman spectroscopy. To carry out this research, 100 fertilized eggs of Iranian native chickens were used. The sex of the embryos was determined using Raman spectroscopy with a wavelength of 785 nm during the fourth day of incubation. Validation of this method was investigated using the polymerase chain reaction (PCR) technique. Sequence alignment of CHD-Z and CHD-W allele sequences amplified by PCR technique. The amplified DNA fragments were single and double DNA bands in the size of 461 bp for the CHD-Z and 322 bp for the CHD-W genes. The PCR was carried out using a PCR master kit with specific primers (the forward primer: 5′- TATCGTCAGTTTCCTTTTCAGGT -3′, the reverse primer: 5′- CCTTTTATTGATCCATCAAGCCT -3′). Thermal cycling conditions for DNA amplification were: 1 cycle of initial denaturation at 94°C for 5 minutes; 35 cycles comprising 30s at 94°C for the denaturation, 30s at 59°C for annealing, 30s at 72°C for the elongation; and a final extension cycle at 72°C for 5 minutes. The PCR products were analyzed by electrophoresis on 2.5% agarose gel against a DNA Ladder 100bp, and visualized using the safe staining on UV transilluminator. The data obtained from the Raman spectrometer was analyzed using the Origin software. The main indices used to study the data were the intensity of the Raman peaks and the ratio of the dominant peak intensity. Additionally, principal component analysis (PCA) was employed to identify any patterns in the data. To calculate PCA1 and PC2, the ratios of I769/I838 and I1141/I1251 peaks were considered, respectively. PCA analysis can choose features that have a greater impact on the final result, depending on the data and the scope of their changes. The result of PCR showed that one fragment with a length of 461 bp was amplified for male embryos (ZZ) and two fragments with lengths of 461 and 322 bp were amplified for female embryos (ZW(. The study found that there are differences in the intensity of Raman bands between genders. Males have higher intensity while females have lower intensity. Therefore, changes in Raman spectra intensity can be used to identify gender. Additionally, the candlestick chart of the data showed that median and average values for males were larger than for females. Furthermore, the results obtained from PCA analysis showed that the variance percentages for PC1 and PC2 were 53.69% and 46.31%, respectively. PC2 is more reliable as it has less deviation. Based on the results obtained from the study, it can be concluded that Raman spectroscopy is a reliable method for determining the gender of chicken embryos during incubation. This test is quick, accurate, and can be easily incorporated into the industry to determine the gender of embryos without resorting to the practice of killing day-old chicks. Not only is this method more ethical, but it also offers a high level of accuracy, making it an attractive alternative for the industry. In general, these results demonstrate the potential application of hematological traits in developing an automatic in ovo embryo sexing method through spectroscopic analysis.

Oxidative stress is inevitable in broiler chicken production, and it affects the physiological, behavioral, and biochemical status of growing chicken which ultimately deteriorates meat quality. The imbalance among free radicals and antioxidant enzymes within living cells or tissues leads to the oxidation of lipids, proteins, and nucleic acids and is a fundamental cause of oxidative stress. When the antioxidant mechanism within living cells weakens, the production of free radicals increases under physiological oxygen metabolism, and reactive species (i.e., reactive oxygen species and reactive nitrogen species) are needed in cells in small quantities because they function as signaling molecules during homeostasis. However, excessive production of these species leads to oxidative stress. There is a mechanism in living cells to reduce the number of oxidative species through physiological scavenging. Numerous reactive oxygen species such assuperoxide and hydrogen peroxide are produced during oxygen metabolism. In addition, some reports showed that after the occurrence of oxidative stress, there are severe inflammatory reactions in the cells involved, which can lead to greater tissue damage and activate tissue apoptosis. Oxidative stress plays an essential role in the emergence of a number of chronic disorders such as diabetes and cancer by inducing inflammation. To protect against free radicals, living organisms have a combined antioxidant defense system including enzymatic system (such as glutathione peroxidase, superoxide dismutase, and catalase enzymes in the cytosol and cell membrane structure) and a non-enzymatic system (such as glutathione, polyphenol, carotenoids, special dipeptides, proteins containing thiol group, polyamines, ubiquinol, flavonoids, bilirubin, uric acid, vitamin E with selenium, and vitamin C) in tissues. Black cumin seeds (Nigella sativa) have been used as alternative medicine for more than 2000 years due to their multisystemic positive effects. Many active components of black cumin have been identified, including dithymoquinone, thymoquinone, nigellone, thymohydroquinone, nigilline, melanthin, nigelamine, damascenone, pinene, and p-cymene. Black cumin contains minerals such as calcium, magnesium, potassium, iron, phosphorus, cobalt, zinc, and manganese, and vitamins A, B, C, D, and E. Moreover, black cumin is rich in essential oils, proteins, alkaloids, saponins, flavonoids, and polyphenols. The black cumin has anti-inflammatory, analgesic, anthelmintic, hypocholesteremia, appetite stimulant, antidiarrheal, diuretic, antiulcer, spasmolytic and bronchodilatory, antimicrobial, antihypertensive, antidiabetic, anticancer, hepatoprotective, and renal protective activities and has antioxidant properties. This study was conducted to investigate the effects of black cumin on growth performance, antioxidant status, inflammatory responses, and biochemical and hematological changes in broilers under oxidative stress induced by hydrogen peroxide.

A total of 200 one-day-old chickens (Ross 308) were reared in the form of a completelyrandomized design with four treatments and five replications (10 chickens per replicate). Experimental treatments included: 1. Control group (fed with basic diet), and groups 2, 3, and 4 had levels of 50, 100, and 150 g of black seed per kg of diet. To induce oxidative stress, all birds received 1% hydrogen peroxide per liter of drinking water from 14 to 42 days of age. At 42 d, two birds were randomly selected from each cage and after blood sampling from the wing vein, were killed and dissected for liver and spleen tissue sampling. Growth performance, blood and biochemical parameters such as the number of red and white blood cells, hemoglobin, hematocrit, heterophil and lymphocyte, serum triglyceride, and cholesterol, as well as serum antioxidant parameters including the level of malondialdehyde (MDA) and the activity of antioxidant enzymes including glutathione peroxidase, superoxide dismutase, and catalase, were determined. In addition, liver enzymes present in the serum including alanine aminotransferase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP) were measured. Also, to evaluate the effect of black cumin on the inflammatory response of broiler chickens under induced oxidative stress, serum interleukins including IL-10, IL-6, and TNF-α were measured.

The results showed that black seed supplementation in chickens under induced oxidative stress significantly improved the growth performance, increased the activity of antioxidant enzymes, and decreased MDA in serum, liver tissue, and spleen (P<0.05). Black seed supplementation significantly decreased serum levels of inflammatory cytokines of IL-6 and TNF-α, and increased anti-inflammatory cytokine of IL-10 (P<0.05). Also, black seed supplementation did not affect red blood cells, hematocrit, or hemoglobin, but increased white blood cells, lymphocytes, and decreased blood heterophils (P<0.05). Serum levels of triglycerides, cholesterol, ALT, AST, and ALP also decreased significantly under the influence of black seed.

Based on the results of this experiment, it appears that black cumin (Nigella sativa) seed supplement can improve the growth performance of broiler chickens due to its antioxidant and anti-inflammatory effects.

The decrease in the sperm number in each dose of artificial insemination (AI) has led to the deterioration of sperm quality in different species. Decreasing sperm quality could be a major obstacle to the commercial application of flow-sorted sperm for gender selection. The reduction in the viability of cryopreserved spermatozoa at high dilution rates (low number of sperm/dose) has been attributed to the lack of useful components of the seminal plasma in the final freezing medium. Although the effect of adding or removing seminal plasma or its proteins on sperm activity has been widely investigated, the results of these studies are contradictory. Factors such as the final dilution rate and the extenders used in each work may influence the results. On the other hand, a milk-based extender was reported to be better than a Tris-citrate-fructose extender for a percentage of uncapacitated and linear motile spermatozoa after freezing-thawing of ovine semen. However, milk-based diluents interfere with the evaluation of sperm kinematics by the computer-assisted sperm analysis (CASA) systems. It is speculated that by adding milk to the composition of Tris diluents while taking advantage of the positive effects of milk, problems related to sperm evaluation disorders by CASA will not occur. Therefore, this study aimed to investigate the impacts of adding bovine skim milk and seminal plasma into the formulation of a Tris-citrate-egg yolk LDL extender on the kinematics and viability of frozen-thawed bull sperm when sub-optimal sperm numbers were packed in straws.

Semen samples were collected from four bulls once a week for four consecutive weeks. The ejaculates collected on the same day were pooled provided that the semen concentration and progressive motility in each ejaculate were ≥2×109 cells/mL and ˃70%, respectively. The semen pool was divided into four equal aliquots and diluted with experimental extenders to obtain a final sperm concentration of 15×106 spermatozoa per mL. The base extender [made by Tris buffer (80% v/v), liquid ammonium sulfate-insoluble yolk fraction (20%), and glycerol (7% v/v)] was supplemented with 0, 5, and 10% (v/v) milk, and 0, 2 and 5% bovine seminal plasma. Therefore, the experiment was conducted in a completely randomized design with a factorial arrangement of 3×3. Diluted semen samples were frozen and stored in liquid nitrogen after being cooled and packed in 0.5 mL straws. The percentage of live cells in thawed samples was determined after Eosin-nigrosin staining and motility and kinematic parameters were analyzed by CASA. Data were subjected to analysis of variance using the general linear model of SAS software (version 9.2). Significant differences among treatment means were evaluated using the Tukey test. The statistical significance level was set at 0.05.

The results indicated that the addition of milk at both 5 and 10% led to an increase in progressive motility, straightness, and sperm velocity parameters (Average path velocity, curvilinear velocity, and straight-line velocity). Adding 5% seminal plasma to the basal extender formulation increased the motility indexes (total and progressive motility), velocity indexes, and directional indices of cryopreserved spermatozoa. Among the parameters reflecting sperm wobble characteristics, wobble and amplitude of literal head increased; however, beat cross frequency and mean angular displacement decreased in the freeze-thawed spermatozoa diluted in the extenders containing 5% seminal plasma compared to those in the control straws. The average concentrations of both factors (5% milk and 2% seminal plasma), when present together in the base composition of the diluent, have shown a better result in terms of percentage sperm viability than when present alone.

According to the results, adding 5% seminal plasma to the extender formulation increased the kinematic parameters of frozen-thawed sperms. However, it should be noted that these increases do not seem to be desirable in sperm doses for artificial insemination but could be acceptable for in vitro fertilization (IVF). However, the 2% level of seminal plasma reduced the mean angular displacement parameter without affecting the velocity indices, which may indicate an improvement in sperm fertility. The addition of 2% semen plus 5% milk in bull semen diluent has resulted in better sperm viability. In addition, the 5% proportion of milk improved many parameters of sperm motility and kinematics, as did the 10% proportion. Therefore, the addition of 2% bovine seminal plasma plus 5% skimmed cow's milk to a Tris-LDL-citrate extender may positively affect the viability of frozen-thawed bull sperm and kinematic values ​​associated with fertility when semen is diluted in small amounts/doses.

Minerals are a small part of the diet, but their deficiency has major consequences for the health and reproduction of animals. Iron is not only one of the most abundant elements on Earth (it is the fourth most common element in the Earth's crust), but it is also a vital component of living things and an essential nutrient for all animal species. The main source of iron for calves and other newborn ruminants is milk or milk replacer. Milk contains relatively small amounts of iron, and calves are prone to iron deficiency. In most dairy farms, iron supplements are added as an inorganic source to the diet, which can undergo oxidation and react with other substances, causing a decrease in solubility. To solve this problem, the desired elements should be added to the ration of livestock in the form of chelated supplements. Research shows that iron plays an essential role in several metabolic processes and is necessary for the synthesis of DNA, RNA, and proteins in the body. Dietary supplements with iron have increased hematology parameters and improved growth. In addition, the presence of iron in the diet is effective in increasing appetite and glucose metabolism. Based on this, this study was conducted to investigate the effect of chelated iron supplement containing organic acid and amino acid on the performance, skeletal growth indices, fecal score, and blood parameters of suckling calves.
36 newborn male calves (with an average weight of 35.1±2.7 kg) were randomly divided into three groups with 12 replicates. The treatments included the control group (basic diet without iron supplement), basic diet with chelated iron supplement containing organic acid, and basic diet with chelated iron supplement containing amino acid. The length of the trial period was 63 days. During the experiment, calves were kept in separate locations. The rations were based on the National Research Council (NRC) report which was published in 2001. The rations were provided by total mixed ration (TMR) in calves at 8 am and 4 pm and animals had free access to water. Milk feeding was also performed in the morning and evening (10% of body weight). Calves were weighed every 21 days. The amount of feed consumed and post-feed was recorded daily. Skeletal growth in the body was measured using a standard measuring device and caliper. Three days a week, the calves' feces were randomly evaluated. On the last day, three hours after the morning meal, calves were sampled from the veins and blood parameters were determined. Sampling was done using venoject tubes with and without heparin and the samples were immediately centrifuged at 3000 rpm for 10 minutes to separate the plasma and kept at -20ºC until the day of the experiment. Glucose, urea, triglyceride, cholesterol, total protein, albumin, and globulin were determined using a Pars Test automated analyzer and kit. The measurement of mineral elements in blood serum (iron, zinc, copper, calcium, and phosphorus) was done by atomic absorption device.
The results showed that calves receiving chelated iron supplements with amino acids had an increase in the final weight, total period weight, and daily weight, and a decrease in feed conversion rate compared to the control group and treatment receiving chelated iron supplements with organic acids (P<0.05). Also, there was no significant difference in terms of dry matter and milk consumption among different treatments. There was no significant difference in terms of skeletal growth indices among different treatments. Fecal score and diarrhea status improved in both treatments receiving iron supplements (P<0.05). Consumption of iron supplements by calves in both chelated forms containing organic acids and amino acids increased blood glucose and iron and decreased blood copper and phosphorus (P<0.05). However, cholesterol, triglyceride, urea, total protein, albumin, and blood globulin were not affected.
In general, according to the results of this research, the intake of chelated iron with amino acids is recommended due to the improvement in the performance of suckling calves.

Large parts of Iran have a dry and semi-arid climate, which is why opportunities for fodder production in the country are limited. Providing feed from agricultural by-products, including potato vines, can be considered a suitable option to compensate for the limitations of traditional feed (e.g. alfalfa). Ardabil province has about 15-20% of the country's potato cultivation area, and with the annual production of about 800 thousand tons of potato tubers, it ranks second in the country. Therefore, there is great potential in this province to produce by-products related to potatoes. The present study was conducted to investigate the possibility and effect of replacing potato vines with regular forage in the diet of pregnant sheep (during the last 45 days of pregnancy).

In the first step of this research, the chemical compositions of alfalfa hay and potato vine including dry matter, organic matter, ash, crude protein, crude fat, neutral detergent fiber (NDF), and acid detergent fiber (ADF) were determined. In the next phase, 210 pregnant Moghani sheep were randomly assigned to seven treatments with three replicates and 10 sheep per replicate. In addition to the control treatment (pasture feeding), six treatments with different levels of potato vine (zero, 16, and 32%) were used in two food forms, mash and complete block. The mentioned diets were given to the animals in the last 45 days of pregnancy in the amount of 500 grams during the night feeding time. It should be noted that lactating ewes were not subjected to any treatment after lambing and the effect of an additional feeding period on milk production was examined after three months of lambing.

According to the results obtained, the percentage of dry matter, crude protein, crude fat, gross energy, and ADF in potato vine was not significantly different from alfalfa feed, but the NDF percentage in potato vine was lower than alfalfa and its ash content was more than alfalfa (P<0.05). No significant difference was observed in the amount of dry matter digestibility (DMD) and dry organic matter digestibility (DOMD) between the potato vine and alfalfa hay. Ewe weight gain during the supplementary feeding period was influenced by different treatments (P<0.05). A similar pattern was observed for other traits such as ewe weight after lambing, birth weight of lambs, weight gain before weaning, and, weaning weight of lambs. In the current study, the examined traits in sheep that were fed with complete block showed better performance compared to sheep fed with mash. In this feeding method, animals are not able to choose due to the uniform composition of food, which leads to a uniform effect on the rumen and thus reduces the fluctuation in ammonia release for more efficient use of non-protein nitrogen. Complete block feeding is an efficient method to increase voluntary feed intake in ruminants. It also improves nutrient utilization by stabilizing fermentation in the rumen. The increase in birth and weaning weight in lambs whose mothers were fed complete block diets showed that the use of supplementary feeding in the last weeks of gestation of ewes, when carried out appropriately, leads to improvement in fetal growth and proper development of the mammary gland, and increase in birth weight of the lamb and milk production. The different treatments have a significant impact on the amount of milk production so that the average daily milk production throughout the lactation period was lowest in the control treatment (without using any nutritional supplements) and highest in the block feeding treatment at 16% Potato vine. The results showed that using the complete block produced a higher profit compared to the mash.

Based on the results of the present research, the use of 16% potato vine as a replacement for part of the usual fodder in the form of a complete feed block resulted in profitability in the nomadic sheep farming system. Given the cheap price and availability compared to alfalfa fodder and wheat straw, especially in drought conditions and poor pastures, its consumption is economical.

In many countries of the world, the camel has played an important role in the lives of people in arid and semi-arid regions in terms of providing milk and meat products. Based on phenotypic characteristics, the camel has been adapted to the deserts from physiological, anatomical, and behavioral points of view. Due to limited water resources, the south Khorasan province of Iran has not been an appropriate geographical region for a great number of agricultural products. Weighing plays an important role in the management of camel breeding to adjust the nutritional needs and also the annual evaluation of the animals. One of the main challenges of camel breeding is the difficulty of recording and the lack of records due to the wild nature and also the large size, especially in adults. Due to the many difficulties and risks, camel breeders usually use various potential alternative tools such as apparent estimation or weighing tape to estimate the weight of camels at different ages. For farm animals, significant correlations between body measurements and body weight can be used as a tool to estimate the weight of animals through a mathematical equation. The main objective of this study was to compare the accuracy of artificial neural network (ANN) and multiple linear regression model (MLR) in estimating the body weight of a humped camel.
In the present study, the data of a total number of 177 one-humped camels in four groups  (including 1. 63 adult female Pakistani camels aged between 9 and 12 years, 2. 21 adult female Baluchi camels aged between 9 and 12 years, 3. 93 male and female camels less than 2 years of age of Pakistani and Baluchi breeds, and 4. total camels) collected at the South Khorasan camel breeding station in 2019 were used. Morphological characteristics of camels include: neck length, neck girth, hand length, foot length, shoulder height to the ground, hump height to the ground, hip height to the ground, chest girth, chest width, abdomen girth, hip width, tail length, breast height, and breast girth were measured. After measuring the body dimensions, the evaluated camels were weighed using a 1000 kg digital scale. To estimate the weight of camels from their body dimensions, the data were analyzed using the MLR model and ANN with the nnet package in R software. For ANN analysis, 80% of the data were considered for network training and 20% for testing. The accuracy of MLR and ANN for camel body weight estimation was compared using the coefficient of determination (R2), root mean square error (RMSE), mean absolute error (MAE), and mean absolute percentage error (MAPE).
The results of the MLR model showed that body dimensions of shoulder height to the ground, chest girth, abdominal girth, neck girth, and hand length had a significant effect on body weight (P<0.05). In the ANN model, chest girth, abdominal girth, and shoulder height to the ground were the most important variables in estimating the body weight of camels of the whole population. The MLR and ANN models had acceptable accuracy in weight estimation. However, compared to the MLR model, the ANN model had a higher R2 and a lower error in estimating the weight of camels. In the first group, R2 and RMSE were found to be 0.996 and 6.852, respectively, for ANN while the corresponding values were 0.979 and 22.955, respectively, for MLR.  In the second group, R2 and RMSE were found to be 0.995 and 3.525, respectively, for ANN while the corresponding values were 0.989 and 5.377, respectively, for MLR.  In the third group, R2 and RMSE were found to be 0.896 and 13.959, respectively, for ANN while the corresponding values were 0.849 and 17.549, respectively, for MLR. In the fourth group, R2 and RMSE were found to be 0.929 and 20.248, respectively, for ANN while the corresponding values were 0.903 and 38.505, respectively, for MLR. The results showed that ANN is more accurate compared to MLR in predicting the body weight of camels. 
In terms of goodness of fit (including R2 and RMSE), the results of the present research suggest that both MLR and ANN methods have high acceptable accuracy for predicting body weight in camels. ANN was more suitable compared to MLR, suggesting that it could be used to predict camel body weight. Furthermore, grouping the camels by age and breed could also lead to higher precision and lower prediction error.