فصلنامه مطالعات حفاظت گیاهان
سال سی و هفتم شماره 3 (پاییز 1402)

Narcissus (Narcissus tazetta) is one of the perennial herbaceous and ornamental bulbous crops that is used as a cut flower garden plant and potted plant. Fungal diseases are one of the harmful factors of this ornamental plant in different parts of the world. In 2018, symptoms of Narcissus leaf spot (NLS) were observed in some planting areas of this plant in South Khorasan province. This study was carried out to identify the casual and associated fungi with NLS in Southern Khorasan province.

Samples with leaf spot symptoms were collected from two regions, Khoosf and Tabas, from 2018 to 2019. Plant tissues were transferred to the laboratory of the Department of Plant Protection in separate paper bags. The tissues were cultured on a Potato Dextrose Agar (PDA) medium and purification was performed on a 2% water-agar medium using the Hyphal tip method. Fungal agents were isolated and identified based on morphological and molecular characteristics.  The DNA of representative fungal isolates was extracted according to the CTAB method. To molecularly confirm the species, part of the rDNA gene was amplified using ITS5 (5'-GGAAGTAAAAGTCGTAACAAGG-3') and ITS4 (5'- TCCTCCGCTTATTGATATGC-3') primers. Sequencing of PCR products was done by Pishgam Biotechnology Company and deposited in the GenBank with Accession number: MN829259. Sequences were edited with Chromas software and the edited sequences were saved in FASTA format. The ITS-based phylogenetic tree was constructed using the Maximum Likelihood Method with MEGA ver6.0 software. For the pathogenicity test, the Narcissus plant was inoculated with mycelia plugs. In order to maintain moisture and establish the fungus, the inoculation area was covered with parafilm.  The plants were covered with polythene bags for 24 hours. The bags were removed after 24 hours. In the control plants, the potato-dextrose-agar culture medium without fungal mycelium was used. All plants were examined after 3 to 14 days and the pathogen was re-isolated from the inoculated plant that showed leaf spot.

Symptoms of narcissus leaf spot (NLS) disease in the sampled areas included elongated, elliptical, and red to brown circles on the leaf. A total of 50 samples of different leaf spot symptoms were collected. In this study, 20 fungal strains were isolated and identified based on morphological and molecular characteristics. The growth rate of this isolate on the PDA medium was relatively fast and the average growth rate after 7 days was 6.6 cm. Pycnidia were formed abundantly on the PDA medium after 7 days. The pycnidiospores were transparent, mostly single-celled (3-4×5-7), sometimes two-celled (11.5-15 ×5.8), round to oval and curved. Chlamydospores (8-15) were dark brown, unicellular and multicellular, intercellular and rarely terminal. Based on morphological characteristics, the strains were finally identified as Phoma narcissi.The NCBI blast search revealed that the ITS region Phoma narcissi in our study had similarities to Didymella curtisii, Phoma narcissi, and Phoma sp. 100%, 100%, and 99% respectively. Phylogenetic analysis confirms that the examined strain belongs in a clade with strains of Ph. narcissi. In Pathogenicity tests, symptoms of the disease were observed on all plants 7 days after inoculation. No symptoms developed on non- inoculated plants. The original pathogen was re-isolated from the leaf spots of inoculated plants. Phoma s.l. is one of the most ubiquitous fungal genera, characterized by its great ecological diversity and difficult identification. According to our knowledge, the main cause of NLS disease in the east of the country is the Ph. Narcissi, Fusarium sp. and Cladosporium sp. were associated agents with this disease. Since the identification of the disease agent is effective in choosing effective and efficient strategies for disease control, the results can help to adopt effective methods in disease management.

Citrus tristeza virus (CTV) is one of the most devastating citrus diseases in Iran. The CTV genome is a positive single-stranded RNA molecule with a size of 19.3 kb containing 12 open reading frames (ORFs). CTV encodes two different coat proteins, of which the small coat protein (CPm) covers only the 3' end of the genome. CTV infected trees show symptoms such as stunting, yellows, reduced vigor and death. In addition, CTV generates three typical disease syndromes, including quick decline, stem pitting and seedling yellows. In total, more than 259 thousand hectares of citrus are grown in the north and south of Iran. Considering the lack of the complete genome sequence of Iranian CTV isolates and the different climatic conditions in citrus cultivation in the north and south of Iran, the genome of CTV isolates from Iran was determined for the first time and their phylogenetic relationships with other CTV isolates were studied.

In spring and fall 2015, 30 samples from Mazandaran province in northern Iran and 25 samples from Fars province in southern Iran were collected from trees suspected of being infected with CTVs. Total RNA was extracted using the RNX-Plus kit according to the manufacturer's instructions. CTV was identified using the specific primer pair CPF (5¢AAAGAAGGCGACGATGTTGT3¢) and CPR (5¢AGCTCCGGTCCAAGAAATCTG3¢) designed based on the coat protein gene of CTV. Reverse transcription was performed using MMuLV reverse transcriptase (Pars Tuos, Iran) and PCR reaction was performed using Amplicon 2x PCR Master Mix (Amplicon, Denmark). Infected samples were grafted onto sour orange seedlings. sRNAs were extracted using a protocol developed by Carra et al. (2006), and sRNA libraries were prepared according to the CATS protocol (Turchinovich et al., 2014). One microgram of each library was sequenced on the Illumina HiSeq2500 platform from Macrogen, South Korea. The CTV strains were determined by virtual replication and digestion or alignment of the region between the small coat protein (Cpm) and coat protein (Cp) genes. The phylogenetic tree was constructed by the maximum likelihood method using the T92+I nucleotide substitution model with 500 bootstrap repeats by MEGA7. The nucleotide and amino acid similarity matrix was calculated using SDTv.1.2 software. Potential recombination events in the genome were determined using RDP v.5.5.

CTV infection was detected in 17 samples from Mazandaran province (56% of samples) and in 8 samples from Fars province (33% of samples) using a CPF/R-specific primer pair. CTV symptoms were mild to severe stunting, chlorosis, yellowing, vein yellowing, and severe decline in the citrus samples from the north of Iran, while CTV symptoms in the samples from the south of Iran were stunting, chlorosis, dieback and quick decline. Three months post inoculation, symptoms of severe stunting and chlorosis appeared in seedlings inoculated with isolates from the north, while mild stunting and yellowing appeared in seedlings of sour orange inoculated with CTV isolates from the south. By assembling the contigs obtained from the RNA-seq data, the complete genomes of IR-North1, IR-North2, IR-South1, and IR-South2 isolates were reconstructed with lengths of 19296, 19302, 19252, and 19251 nucleotides, respectively. The Iranian CTV isolates had nucleotide similarity in the range of 95.2-77.5% with other CTV isolates deposited in GenBank. The polymerase, P65, and coat protein genes of the Iranian CTV isolates showed identity at the amino acid level of 80.6-94.1%, 88-93.9%, and 92.4-96.4%, respectively, with other CTV isolates. Analysis of the CTV strains revealed that IR-North1 resembles the severe decline strain belonging to genotypic group T36, while IR-South2, IR-North2, and IR-South1 belong to the stem pitting and seedling yellows strains of genotypic group VT/T3 and are similar to strains T3, SY, and T318A, respectively. In the phylogenetic tree based on the full length of the CTV genome, three subclades were designated: VT, T68, and T36. IR-North2, IR-South1, and IR-South2 isolates were grouped into VT, and IR-North1 isolate was grouped into T36. Like the reference CTV isolate, the four Iranian CTV isolates had 12 open reading frames. Examination of the Replicase, RdRp, P65, P61, CPm, and CP proteins revealed 280 amino acid substitutions in 33 conserved motifs in Iranian CTV isolates. The isolate IR-North1 had only five substitutions; however, 97, 85, and 93 substitutions occurred in the isolates IR-North2, IR-South1, and IR-South2, respectively. Most substitutions were found in the replicase and p61 proteins, which are involved in virus replication and assembly, respectively. RdRp and p23 proteins had the least amino acid substitutions. No known conserved motif was observed in P33, P6, P18, P13, and P20 proteins. In addition, IR-North1, IR-North2, and IR-South1 were recombinant. In IR-North1, 1426 nucleotides in the P65 gene and 773 and 2444 nucleotides in the replicase gene were recombinant in IR-North2 and IR-South1 isolates, respectively.

An analysis of symptoms, nucleotide diversity, dominant strains, and the phylogenetic relationship of the four Iranian CTV isolates sequenced in this study revealed that two isolates from northern Iran were quick decline and seedling yellows strains, falling within the genotypic groups T36 and VT. These groups were distinguished by distinct symptoms and a separate phylogenetic position. Conversely, the two southern CTV isolates were closely associated with CTV stem pitting strains, classified into genotypic groups VT and T3, sharing a close phylogenetic position.

The striped bug, Graphosoma lineatum L. is one of the pests of Apiaceae family such as parsley, carrot, celery and some medicinally important plants. The adults and nymphs of this insect feed on seeds of host plants. The eggs of the striped bug have an important role in mass rearing program of some parasitoids. Nutritional supplements undertake an essential function in mass rearing of insects and increase the efficiency of production. Vitamins such as B group have different functions in physiology of insects. The growth and development of insects hinge on acquiring essential nutrients through food materials. Apart from their primary food source, insects rely on essential amino acids and certain minerals for proper nutrition. These crucial components must be obtained from their food sources. Symptoms of nutritional deficiency, as reported in various research studies, include delayed growth, weight loss, prolonged immature stages, increased mortality, wing deformities, alterations in mating behaviors, and various physiological issues. In this study the effects of some vitamins and amino acids on anatomy of salivary glands, total protein of body, developmental time and fecundity of G. lineatum were evaluated in controlled conditions.

Insects reared on parsley seeds adhered on the inner side of big plastic containers in controlled condition. Supplements including vitamins B12, B6, B1 and Serine and Phenylalanine amino acids selected for evaluation. These supplements used for the treatmnet of G. lineatum in four different concentrations dissolved in water. For evaluating the effects of nutritional supplements on anatomy of salivary glands, both glands separate after dissection of adult’s thorax, and dimension of glands including width and length of posterior and anterior lobs, measured by micrometer apparatus located on stereomicroscope. Total body protein measured by Kjeldahl apparatus after well drying the total body of insects in oven followed by fine powder of dry materials. Total protein was determined using a standard method, calculated by multiplying the nitrogen amounts by 6.38, a constant value. In distinct experiments, the impact of nutritional supplements on the duration of each nymphal stage was investigated. One-day-old eggs were employed for this purpose. Following treatment justification, the time required for the development of each instar was recorded on a daily basis. All tests were replicated three times, with distilled water used for the control treatment. The data were analyzed by One-way ANOVA experimental randomized design and Duncan’s multiple range test using SAS software used for comparing the means.

The results disclosed a significant impact of all vitamins and amino acids on all studied parameters. Notably, in the case of salivary glands, the posterior lobe exhibited a more pronounced effect in insects fed with B1, B6, and Phenylalanine. Different concentrations of vitamin B6, B1 and Phenylalanine affected total protein content of male and female insect’s body. Vitamin B12 had non-significant effect on male and female total body protein. Nutritional supplements changed the rate of laid and hatched eggs in addition with nymph’s developmental time. Vitamin B12 in the concentration of 0.005 g/l, B6 in the concentration of 0.25 g/l, B1 in the concentration of 0.5 g/l, Serine and Phenylalanine both in the concentration of 0.5 g/l showed the highest rate of laid and hatched eggs. Vitamin B6 and B1 in the concentration of 1 and 1.5 g/l resulted in prolonging the nymph’s life span in comparing with controls. The negative effects of high concentrations of nutritional supplements on fecundity and normal developmental period of nymphs well documented in this study. Metabolism, cell division, hormone synthesis, enzymes activity and many physiological parameters affects by supplements especially vitamins. Any disorder in utilization, absorption and inhibition of their function leads to biological and behavioral problems in insects. In some cases, the function of symbionts for compensation essential supplements documented.   

The results of this study indicate important function of vitamins B12, B6 and B1 on G. lineatum nymphal developmental period. In high concentrations, rate of growth decreased in comparison with controls. Salivary glands anatomy showed some changes in dimensions especially in posterior lobs in dose-depending manner. Number of eggs laid and hatched decreased especially in high concentrations of nutritional supplements. The results of this study will help to justify better meridic diet for rearing striped bug. In semi-artificial diets for rearing this insect, corporation of little concentrations (optimum) will improve the fitness of insects.

The jujube, Ziziphus jujuba Mill. is a well-known medicinal plant with various nutritional values and pharmacological properties which grows in South Khorasan province, Iran, as the major producer of jujube in Iran. The jujube lace bug, Monosteira alticarinata Ghauri (Hemiptera: Tingidae) is the second most important pest of jujube trees after the jujube fruit fly, Carpomyia vesuviana Costa (Diptera: Tephritidae) in South Khorasan province. Its occurrence in Iran was reported for the first time in 2012 by Moodi from Birjand in South Khorasan province. Adults of M. alticarinata overwinter on the bark of trees, under fallen leaves and in spring they move to young jujube leaves where they feed and lay eggs on the underside, thus starting infestations. Both M. alticarinata adults and nymphs feed on underside of leaves and produce small chlorotic stippling on the upper leaf surface. Leaf undersides appear specifically black varnish spotted due to lace bug excrement. Their injury reduces photosynthesis and respiration and also causes aesthetically displeasing injured leaves. As a result, foliage becomes bronzed and leaves may drop early. The accumulation of excrements on the leaves, also results in reduction of the gas exchange like other lace bugs. Distribution pattern of an insect population is an important aspect as it represents the interaction between individuals of the species and their habitat. The importance of spatial distribution comes from its central role in ecological theories and its practical role in population sampling theory as well as in the development of rational pest management strategies. For these reasons, a great deal of effort has been invested in characterizing the spatial distribution of insect populations. Spatial dispersion of a population usually follows one of three models: aggregated (or contagious), random (or by chance) or uniform (or regular). To determine the spatial distribution pattern of a given species it is necessary to obtain data on the count of individuals in the ecosystem to be considered. Despite the importance of M. alticarinata in the region, no study has been conducted on the distribution of this pest in jujube plant in Iran. Knowledge of spatial distribution of M. alticarinata is useful for designing, pest management and development of population models and assessment of levels of its damage.

To investigate the spatial distribution pattern of different life stages of M. alticarinata, samplings were done weekly of jujube trees in 2020. Jujube leaf was selected as sampling unit and the reliable sample size with maximum relative variation of 20% was obtained 50. The number of egg, nymph and adult was recorded in three heights of jujube trees (1.5, 2, and 3 meters). The spatial distribution pattern of different life stages of lace bug was determined using mean-variance ratio, Lloyd's mean crowding index, Taylor´s power low and Iwao´s patchiness regression model.

Spatial distribution of an insect is affected by various environmental factors such as food, temperature, light, habitat condition, and other biotic and abiotic factors. The results of the study indicated an aggregated pattern for the spatial distribution of M. alticarinata in almost all heights of jujube. In other words, different heights of jujube did not have any marked effect on the distribution pattern of this pest. Information on spatial distribution of M. alticarinata can be used in estimating the number of samples required from an area to reliably estimate pest infestation levels to develop effective management programs. Similar to our results, the change in plant height did not affect the spatial distribution pattern of Agonoscena pistaciae and Diaphorina citri nymphs and in both cases the pattern of distribution was reported to be aggregated. Aggregated distribution is the most common pattern of spatial distribution in the world of harmful insects which is consistent with the results of this research.

M. alticarinata presented an aggregated spatial distribution in different life stages. The causes of aggregation in these lace bugs might be due to their inherent active aggregative behavioral response such as in a situation where the presence of one individual attracts the others, perhaps for the purpose of feeding and reproduction. Knowledge of the spatial distribution of this pest can be useful in designation of suitable sampling programs and it makes us estimate the density of this pest faster with low cost.

In conventional formulations such as emulsifiable concentrates (EC), wettable powders, soluble liquids, etc., complete availability of the active agent is usually considered immediate or rapid following usage. Application rates of these formulations of pesticides are greater than the minimum threshold concentration to counter losses from sorption, volatilization, photodecomposition, microbial and chemical degradation, and leaching. Controlled-release technology for pesticides could reduce environmental damage and increase efficiency by enhancement of delivery to the site of action. This survey was conducted to determine the possibility of EPTC and trifluralin efficiency improvement by using microencapsulated formulation (MC) that were first synthesized in Iran.

Two separated greenhouse experiments were conducted in Tirtash Research and Education Center (Mazandaran–Iran) in 2014. The experiments were carried out in a factorial arrangement based on a randomized complete block design with three replications. The Microencapsulated formulation of EPTC and trifluralin herbicides were compared with emulsifiable concentrate formulation (Eradicane 82% and Treflan 48%) in 0 (control), 25, 50, 75 and 100 percent of active ingredient (a.i.) (4.92 and 1.2 kg a.i./ha, recommended doses for EPTC and trifluralin, respectively). For this purpose, the soil of pots were infested with the seed of Green foxtail (Setaria viridis) and Redroot pigweed (Amaranthus retroflaxus). The responses of weeds to treatments, specifically seedling number, were analyzed using ANOVA tests, non-linear regression, and fitting to three parameters of Weibull and log-logistic equations. This analysis was based on Akaike's Information Criterion, Residual Standard Error, and Lack-of-Fit Test indices in the R3.4.1 program. The effective dose were determined for 10, 50 and 90 percent of weed control (ED10, ED50 and ED90, respectively). Relative potency index (R) of formulation types were determined by divided ED50 of EC into MC formulations.

According to the results of the experiments, the formulation type had a significant effect on the weed numbers. The MC formulations of EPTC increased Green foxtail and Redroot pigweed control efficiencies. The ED10, ED50 and ED90 decreased from 0.72, 2.94 and 7.18 kg a.i.ha-1 in the EC to 0.41, 1.87 and 4.89 kg a.i.ha-1 in the MC formulation for Green foxtail and 1.08, 3.29 and 10.02 kg a.i.ha-1 in the EC to 0.57, 2.36 and 9.67 kg a.i.ha-1 in the MC formulation for Redroot pigweed. The R index of EPTC in Green foxtail and Redroot pigweed control were 1.57 and 1.39, respectively. Weed control increased as trifluralin dosage increased in both of the formulation types, although in higher doses of the MC, weed control efficiency increased more than the EC formulation. So the efficiency of the MC formulations depended on application dosages. The ED10, ED50 and ED90 of Green foxtail were 0.14, 0.55 and 1.27 kg a.i.ha-1 in the EC and 0.19, 0.52 and 0.98 kg a.i.ha-1 in the MC formulation. The ED10, ED50 and ED90 of Redroot pigweed were 0.20, 0.64 and 2.02 kg a.i.ha-1 in the EC and 0.26, 0.56 and 1.19 kg a.i.ha-1 in the MC formulation. So that the R index of trifluralin in Green foxtail and Redroot pigweed control were 1.05 and 1.14, respectively. The dependency of trifluralin behavior to applied microcapsule dose may be connected to capture of herbicide in microcapsule particles which it causes reduction of bioavailability of herbicide in soil lower than the threshold doses of injury level. Whiles under this experimental conditions, the herbicides are less affected by degrading agents and therefore have less opportunity to express the advantages of MC formulation. Whereas the field studies results showed that the 50% of the recommended dosage of MC formulation had same efficiency as 75% of the recommended dosage of EC formulations (results were not published).

Microencapsulation is a versatile tool for product design and is successfully used in various sectors and for a variety of different product features. However, although lot of research has been performed, only relatively few developments have made it into products in the agrochemical area. For example 37 actives out of 908 listed in total in the pesticide manual, mainly insecticides, are described as being formulated as control solutions. While the development of this technology in agriculture can play an important role in preserving the environment and reducing the pollution caused by pesticides. The purpose of the application of controlled release formulations is the gradual release of herbicides in a suitable amount with maintaining efficiency in agronomic conditions. This type of formulation is a combination of the herbicide and associated material that releases effective material over a given period due to weed control. The results of this study showed that the R index of EPTC and trifluralin were 1.57 and 1.05 in Green foxtail, and 1.39 and 1.14 in Redroot pigweed control, respectively. So that the microcapsule formulation of EPTC and trifluralin herbicides increased the efficacy and reduced the application dose.

Peppermint (Mentha piperita) is considered as one of the oldest medicinal plants. It is herbaceous and perennial belonging to the Lamiaceae family. The production of secondary metabolites in plants is influenced by the environment. Weed competition is of the most effective factors affecting crop yield in medicinal plant production systems, and can influence the quantity and quality of the essence constituents. The extent of crop yield loss depends on presence and competition duration of weeds. A period during the crop growing season in which weeds control is essential to prevent yield loss is called the critical period of weeds control. Respect to the importance of weed presence duration in yield loss, and the variability for critical period of weeds control depending on crop species and cultivar, and characteristics of weeds communities in different areas, and also because of increased interest in medicinal plants production and extraction, and limitation for herbicide application in medicinal plants, it is essential to understand different aspects of weed- peppermint competition. Therefore, the objective of this research was to acquire information about the effects of weed competition duration on peppermint growth and yield, which possibly can lead to integrate various approaches into weed management programs, and improve weed control strategies.

This study was conducted as a randomized complete block design with 12 treatments and three replications at research farm of the University of Guilan. Treatments were arranged in two series including weed-free and weed-infested treatments which respectively hand-weeded and un-weeded from the beginning of the growing season up to 16, 32, 48, 64, 80, and 96 days after crop planting. Peppermint cuttings with 6-8 cm height were hand-planted on 50-cm apart rows with 20 cm spacing between plants (density of 10 plants.m-2) on early May. Peppermint plants were hand-harvested 96 days after planting when 50% flowering occurred at the full-season weed-free plot.

Dominant weed species included barnyard-grass (Echinochloa crus-galli (L.) Beauv.), yellow foxtail (Setaria glauca (L.) Beauv.), annual nutsedge (Cyperus difformis L.), crab-grass (Digitaria sanguinalis (L.) Scop), knotgrass (Paspalum distichum L.), common cocklebur (Xanthium strumarium L.), spurge (Euphorbia indica Lam.) and redroot pigweed (Amaranthus retroflexus L.). Maximum height of peppermint (71.2 cm) was observed in treatments with at least 32 weed-free and at most 32 weed-infested days from the beginning of the growing season. In the other treatments, final height of peppermint plants reduced by 9.1%. Nod number per stem (22 nodes) was not influenced by weed control or interference. The maximum branch number per plant (37.1) was observed in treatments with at least 32 weed-free and at most 48 weed-infested days. The minimum branch number per plant was observed in the full-season weed-infested treatment (14.6) and also in the treatment that hand weeded just 16 days from the beginning of the growing season (17.6). The maximum dry weight of peppermint at harvest (193.62 g.m-2) was observed in treatments with at least 48 weed-free and at most 32 weed-infested days. The minimum dry weight of peppermint was 30.06 g.m-2 and belonged to the treatments including at least 64 weed-infested days, and also to the treatment was weed-infested from 16 days after planting up to the end of the growth seaso. Biological yield of peppermint in full-season weed-free treatment was 2044 kg.ha-1. For control treatments, weedy condition during 16, 32, 48, 64, and 80 days led to a biological yield loss of 0.3, 3.2, 7.8, 27.9, and 87.2%, respectively, whereas for infested treatments, weedy condition during 16, 32, 48, 64, and 80 days caused 4.8, 15.6, 41.5, 75.1, and 87.7% biological yield loss, respectively. Also 91.3% reduction was recorded for biological yield of full-season un-weeded treatment. The highest percentage and yield of peppermint essence were observed in treatments of 64, 80, and 96-day weed-free (3.38% and 68.30 kg.ha-1). The least essence percentage was 0.48% and was recorded for 96-day (full-season) weed-infested treatment. The least essence yield was belonged to 96, 80 and 64-day weed-infested, and 16-day weed-free treatments (4.4 kg.ha-1).

In general, the growth and yield of peppermint diminished with decreasing weed-free duration and increasing weed-infested duration. Full-season weed competition compared to the full-season weed-free control, reduced height, branch number, biological yield, essence percentage, and essence yield of peppermint by 13.5, 61.1, 91.3, 86.3, and 98.8%, respectively. These results support the importance of weed management in peppermint, as weeding was necessary from 22 to 49 days after peppermint planting by accepting up to 5% yield loss, and from 29 to 42 days by accepting up to 10% yield loss.

Diclofop-methyl is labeled for use in wheat and barley to control many grassy species, e.g., the genus Avena. Efforts should be made to use diclofop-methyl correctly, allowing the reduced doses to be applied. The response of herbicides to spray volume is different. After determining a suitable spray volume for a foliage-applied herbicide, the next step is to adjust it. The spray volume can be adjusted by two methods the change in application speed or nozzle size. If less spray volume is necessary to apply an herbicide, it is needed to increase application speed. It causes the spray droplets to be more bounced or shattered from the leaf surface, causing the herbicide not to achieve optimal efficacy. Therefore, selecting a smaller orifice nozzle is much more applicable, of course, if the spray drift is controlled. The surface tension of water, which is used to spray herbicides, can be slightly reduced after adding the formulation of herbicides. Therefore, the relatively high surface tension of the spray solution poses three main problems. First, the spray droplets can easily be bounced off the leaf surface. Second, those remaining on the leaf surface after impact have a relatively spherical shape. Third, the crystalline wax in the cuticles, is considered an essential barrier to penetrating herbicides into the leaf tissues. It is well-established that the three main issues mentioned above can be addressed by selecting a suitable surfactant to add to the spray solution. This addition enables optimal efficacy of the herbicide. Consequently, numerous previous studies have highlighted the superiority of trisiloxane surfactants over non-silicone surfactants in enhancing herbicidal activity. This study aims to assess whether the effect of spray volume, adjusted by changing nozzle size, on the herbicidal activity of diclofop-methyl could be influenced by two types of trisiloxane surfactants – one with super wetting properties and the other with non-super wetting properties.

A greenhouse trial was performed as a dose-response relationship at the Bu-Ali Sina University, Hamedan, Iran. The experiment was designed as a four-factor completely randomized design. The first factor was the dose of diclofop-methyl (Illoxan® EC 36%) including 0, 112.5, 225, 450, 900 (labeled dose), and 1350 g ha-1. The second factor was spray volume, including 60, 120, 240, and 480 L ha-1, which were adjusted using 1100075, 110015, 11003, and 11006 flat fan nozzle, respectively. The third factor was two types of trisiloxane surfactants, Break-Thru® S 233 having a non-super wetting property and Break-Thru® S 240 having a super wetting property. Both are non-ionic surfactants and manufactured by Evonik company in Germany. They formed their critical micelle concentration (CMC) at 0.1% v v-1 at which the surface tension of distilled water (72.1 mN m-1) containing Break-Thru® S 233 and Break-Thru® S 240 was measured to be 24.1 and 22.6 mN m-1, respectively. The fourth factor was surfactant concentration, including 0, 0.0125, 0.025, 0.05, 0.1, 0.2, 0.4, and 0.8% v v-1 (a range from ⅛ to 8 CMC, respectively). A compressor sprayer was used to apply the treatments at 300 kPa spray pressure. A nonlinear regression analysis was conducted to analyze the ‘drc’ using the software R.

A 40% increase in the ED50 value occurred with increasing the spray volumes from 60 to 480 L ha-1 (536.4 and 865.1 g ha-1, respectively), indicating a negative relationship between diclofop-methyl activity and spray volume. Adding Break-Thru® S 233 at 0.025% v v-1 to 60, 120, 240, and 480 L ha-1 spray volumes caused a 1.16, 3.31, 2.04, and 2.13-fold decrease in the ED50 value compared with no surfactant at their corresponding spray volumes, respectively. While, adding Break-Thru® S 240 at 0.025% v v-1 to 60, 120, 240, and 480 L ha-1 spray volumes caused a 1.39, 1.32, 1.34, and 1.19-fold decrease in the ED50 value compared with no surfactant at their corresponding spray volumes, respectively. A decrease in the ED50, attributed to the addition of surfactants, signifies an enhanced activity of diclofop-methyl against sterile oat. This improvement may stem from a reduction in the surface tension of the spray solution, resulting in an expanded retention and/or spreading area of the spray droplets on the leaf surface. This, in turn, facilitates increased penetration of the herbicide into the leaf tissue. These findings indicate that Break-Thru® S 233 works better when added at low concentration to a low-volume spray solution, while Break-Thru® S 240 works better when added at high concentration to a low-volume spray solution. It can be attributed to the difference in the wetting property of surfactants. The natural relationship between diclofop-methyl activity and spray volume at higher concentrations of Break-Thru® S 233 may be related to its phytotoxic effect, resulting in an antagonism effect on diclofop-methyl activity against sterile oat. In the case of Break-Thru® S 240, the relationship mode between diclofop-methyl activity and spray volume was not affected by surfactant concentration indicating the lack of phytotoxic effect by this surfactant.

The current study revealed a negative relationship between diclofop-methyl efficacy and spray volume, which was adjusted by nozzle size. Although this finding differs from a previous study in which spray volume has been adjusted by application speed, they showed that the effect of spray volume on the herbicide’s efficacy depends not only on herbicide but also on how it is adjusted. The smaller, more concentrated spray droplets are necessary to get a better action of diclofop-methyl against sterile oat. However, the negative relationship observed between diclofop-methyl efficacy and spray volume could also be observed with two types of trisiloxane when they surfactants, were used at 0.0125 to 0.1 v v-1. While, when they were used at 0.2 to 0.8% v v-1, the relationship mode changed from negative to neutral for Break-Thru® S 233, but it did not change for Break-Thru® S 240. Moreover, Break-Thru® S 240 works better when added at high concentration to a low-volume spray solution due to the danger of spray run-off, while Break-Thru® S 233 works better when added at low concentration to a low-volume spray solution due to its phytotoxic effect.

The dust storm has become a regional phenomenon due to occurrence of severe droughts. Dust storms, recognized as significant atmospheric phenomena and associated with climate change, exert detrimental effects on plant growth and crop yield. This study aimed to assess the impact of soil dust on the competition between mung bean and red-root pigweed.

An experiment was carried out at the research greenhouse of Faculty of Agriculture at Ilam University during spring and summer 2022. The experiment was conducted as a factorial based on a completely randomized design with four replications. The experimental treatments were included five replacement ratios of mung bean and redroot pigweed (planting patterns 75% mung bean + 25% pigweed; 50% mung bean + 50% pigweed; 25% mung bean + 75% pigweed; monoculture of mung bean and redroot pigweed) and dust were at two levels (0 and 60 gr m-3).

The results showed that the dust causes symptoms of necrosis and leaf burn in mung bean and pigweed. The highest amount of carotenoids (3.59 mg g-1 fresh weight of leaf) was observed in the planting pattern of 75% mung bean + 25% pigweed under no dust conditions. The monoculture of pigweed under dust conditions had the lowest amount of carotenoids. Dust reduced the amount of total chlorophyll, leaf relative water content, plant height and length of inflorescence in Pigweed plant by 23.4, 12, 14.7 and 12%, respectively. Dust caused a decrease in the leaf area in pigweed in different patterns of intercropping. Photosynthesis rate, transpiration rate, leaf area, plant height, number of pods per plant and number of seed per plant in mung bean were respectively decreased by 31.2, 24.9, 28.8, 17.7, 29.7 and 36.7% due to dust application. The highest photosynthesis rate in mungbean (5.28 µmol of CO2 m-2 s-1), leaf area (129.1 cm2) and the number of seeds per plant (13 seed plant-1) were obtained from monoculture of mungbean. However, they were decreased under competition with pigweed. The biological yield in mungbean and pigweed under dust condition were, respectively, 42.6 and 16.8 % lower than that of no dust condition. Under dust conditions, the grain yield of mung bean and pigweed were, respectively, 32.8% and 42.6% lower than that of no dust condition. The actual yield of mung bean under competition with pigweed was lower than the predicted yield indicating the higher competitive effects of pigweed. In all planting patterns with and without dust, the total actual yields were higher than the predicted yield indicating a negative interference effects for mung bean. The relative total yield in most of the planting patterns was greater than one, suggesting increase in the partial relative yield and reduction of intra-species competition in pigweed. The negative effects of pigweed on mungbean were more visible in high densities of pigweed, which also showed a higher positive dominance index. The competition index showed a value greater than one for the pigweed indicating the greater competitive ability of this weed compared to mung bean. Under both conditions, with and without dust, pigweed exhibited the highest relative density coefficient in all planting patterns, establishing itself as the dominant plant compared to mung bean, which had a relative density coefficient less than one. The competition index for mung bean, across all intercropping patterns, was also less than one, indicating its lower competitive ability compared to pigweed. Interspecific competition with pigweed resulted in an actual yield loss for mung bean, highlighting that interspecific competition in mung bean surpasses intraspecific competition. Conversely, pigweed showed a greater susceptibility to intraspecific competition.

The results showed that pigweed has a higher competitive ability and by increased exploitation of environmental resources, cause a decrease in mung bean yield. Despite the high competition ability of pigweed, soil dust cause reduction in its growth and biomass.