s. rostami

During the reconstruction of the lost tooth structure in deep mesio-occluso-distal (MOD) cavities, a combination of amalgam-composite restorations is suggested to simultaneously benefit from the composite resin and amalgam and to minimize their shortcomings. The aim of this study was to evaluate the fracture resistance and fracture mode of premolar teeth with MOD cavities restored by two combined amalgam-composite methods and compare it with intact teeth, amalgam and composite restorations.

In this experimental in-vitro study, 60 intact maxillary premolars, which were extracted for orthodontic treatments, were randomly divided into 5 groups (n=12): Group I (control) included intact teeth and in the other groups, MOD cavities were prepared. Group II: amalgam restoration, Group III: composite restoration (Opalis, incremental filling), Group IV: 2 mm of gingival boxes were restored with amalgam and the rest of the cavities were filled with composite, Group V: 3 mm of gingival boxes were restored with amalgam and the rest of cavities were filled with composite. The samples were stored in distilled water for 24 hours at 37 ºC and underwent thermocycling (500 cycles). Specimens were subjected to a compressive load until fracture, and the fracture resistance was recorded in Newton. The fracture mode of samples was also recorded.

The highest fracture resistance was seen in control group (817±120.3 N) and the lowest was in amalgam group (593±236.9 N), which was significantly lower than the control group (p=0.048). The difference in the fracture mode between the control group and the other groups was significant (p=0.006).

Combined amalgam-composite restorations in MOD cavities can restore tooth strength to a level comparable to intact teeth and similar to conventional composite. The fracture mode was completely favorable only in the control group.

The sex of chickens considerably impacts production performance and economic benefits in poultry farming. Male birds cannot lay eggs and usually have a lower ratio of meat to feed than broilers. Male chicks are typically killed immediately after hatching since they are redundant in the industry and male chicks will neither be suitable for egg production nor meat production. Day-old male chicks in the laying hen industry are usually culled immediately after hatching. As a result, this issue has caused moral concerns in societies. Efforts are underway to develop technology for automatically determining the sex of chick embryos, aimed at establishing a stable and efficient poultry farming system. In large commercial hatcheries, the sexing of newly born chicks is generally accomplished by three different methods according to new hatching lines' vent, color, or feathers. However, these methods are still time- and labor-consuming. If sex can be identified at an early embryonic stage or even before incubation, male eggs could be used as feed components. Moreover, fewer eggs would need to be incubated, which would reduce feed space requirements, CO2 emissions, and energy consumption, which are all economically beneficial to farmers and the environment. In recent decades, researchers have used various in ovo sexing strategies in chicken eggs before hatching or incubation. Some invasive and noninvasive studies that have been conducted for in ovo sexing of chicken eggs can be divided into five major categories: (i) molecular-based techniques, (ii) spectral-based techniques (Raman spectroscopy, fluorescent, 3D X-ray), (iii) acoustic-based techniques, (iv) morphology-based techniques, and (v) volatile organic compound (VOC)-based techniques. Commercially applicable methods must be noninvasive, rapid enough for real-time applications, economically feasible, and ethically acceptable. An alternative method, to prevent the removal of day-old chicks, is a non-invasive method to determine the sex of the egg in the early stages of hatching before the development of the nervous system. Recently, Raman spectroscopy was reported to determine the sex of eggs at the incubation stage. Raman spectroscopy is based on the Raman effect, whereby when incident light (wavelength 750–850 nm) excites molecules in a tissue, the molecules reflect light at a different wavelength. The reflected light's wavelength is characteristic of various chemical components and allows the detection of the atheromatous plaque chemical synthesis. Raman spectroscopy is a powerful tool expected to revolutionize chick sex determination because it can provide information about biological molecules. Thus, Raman spectroscopy is suitable for analyzing living organisms, leading to its widespread adoption across various biological and medical applications. Therefore, resonance Raman spectroscopies have found application in blood analysis, with some studies exploring its utility in chick sexing. For this purpose, the present study was carried out to investigate the feasibility of determining the sex of Iranian native chicken embryos using the Raman spectroscopy. To carry out this research, 100 fertilized eggs of Iranian native chickens were used. The sex of the embryos was determined using Raman spectroscopy with a wavelength of 785 nm during the fourth day of incubation. Validation of this method was investigated using the polymerase chain reaction (PCR) technique. Sequence alignment of CHD-Z and CHD-W allele sequences amplified by PCR technique. The amplified DNA fragments were single and double DNA bands in the size of 461 bp for the CHD-Z and 322 bp for the CHD-W genes. The PCR was carried out using a PCR master kit with specific primers (the forward primer: 5′- TATCGTCAGTTTCCTTTTCAGGT -3′, the reverse primer: 5′- CCTTTTATTGATCCATCAAGCCT -3′). Thermal cycling conditions for DNA amplification were: 1 cycle of initial denaturation at 94°C for 5 minutes; 35 cycles comprising 30s at 94°C for the denaturation, 30s at 59°C for annealing, 30s at 72°C for the elongation; and a final extension cycle at 72°C for 5 minutes. The PCR products were analyzed by electrophoresis on 2.5% agarose gel against a DNA Ladder 100bp, and visualized using the safe staining on UV transilluminator. The data obtained from the Raman spectrometer was analyzed using the Origin software. The main indices used to study the data were the intensity of the Raman peaks and the ratio of the dominant peak intensity. Additionally, principal component analysis (PCA) was employed to identify any patterns in the data. To calculate PCA1 and PC2, the ratios of I769/I838 and I1141/I1251 peaks were considered, respectively. PCA analysis can choose features that have a greater impact on the final result, depending on the data and the scope of their changes. The result of PCR showed that one fragment with a length of 461 bp was amplified for male embryos (ZZ) and two fragments with lengths of 461 and 322 bp were amplified for female embryos (ZW(. The study found that there are differences in the intensity of Raman bands between genders. Males have higher intensity while females have lower intensity. Therefore, changes in Raman spectra intensity can be used to identify gender. Additionally, the candlestick chart of the data showed that median and average values for males were larger than for females. Furthermore, the results obtained from PCA analysis showed that the variance percentages for PC1 and PC2 were 53.69% and 46.31%, respectively. PC2 is more reliable as it has less deviation. Based on the results obtained from the study, it can be concluded that Raman spectroscopy is a reliable method for determining the gender of chicken embryos during incubation. This test is quick, accurate, and can be easily incorporated into the industry to determine the gender of embryos without resorting to the practice of killing day-old chicks. Not only is this method more ethical, but it also offers a high level of accuracy, making it an attractive alternative for the industry. In general, these results demonstrate the potential application of hematological traits in developing an automatic in ovo embryo sexing method through spectroscopic analysis.

Sports rehabilitation is the return of the athlete after medical procedures to the level of fitness that she had before the sports injury. Purpose of this study was to provide a monitoring model for the rehabilitation of injured professional athletes.

This study had a qualitative approach. The statistical population of the research included all specialists and academic staff members of the university in the field of rehabilitation of injured professional athletes in Isfahan province. Purposeful and snowball sampling methods were used to select the participants in the research. To collect data, 18 interviews were conducted between 25 and 45 minutes. The database method was used to identify the components and design the research model with the approach of continuous comparative analysis or simultaneous data analysis. P-Scott's reliability coefficient was used for validation, and its value was 0.83, which is acceptable. The retest reliability in this research was equal to 0.84, which confirms the reliability of coding.

After three stages of coding, 50 open codes were identified, which were divided into 13 axial codes and three selective codes including structural (organizational factors of the club, fans, management, teammates, and coach), individual (psychological, moral, personality, and specialized) and environmental (media, sports-medical facilities, insurance and family) were divided.

Rehabilitation of injured professional athletes includes three structural, individual and environmental dimensions. The structural dimension includes the organizational factors of the club, fans, management, teammates and coaches, and follow-up on the health and well-being of the injured player, material and spiritual support for the injured athlete, club fans' and personal expectations from the injured athlete. Seen, the relationship with the fans and the theoretical and practical knowledge of the coach are important in working with the injured athlete. Individual factors include psychological, moral, personality and specialized components, and in this dimension, having motivation during treatment, emotional stability during treatment, moral orientation, social relations, being committed, paying attention to values, having patience and Patience during treatment, having sports literacy and practicing and correcting technique at the time of injury are important. Environmental factors include sports-therapeutic facilities, insurances, media and family, and the role of bodybuilders, coaches, psychologists, rehabilitation specialists, medical specialists and treatment staff, the quality of the training place, personal (having life-liability insurance), club (treatment), the level of family support and the level of family expectations are the most important things. It is suggested to hold appropriate training courses in this regard for the trainers of this field.

Explosions are inevitable in today’s world; therefore, building structures may be dynamically loaded by an intense loading during the explosion. This is why regulatory bodies have provided instructions for determining the response of structures under the explosion load. Previous research has shown that when the explosion happens close to a structure, the ground explosion load can be modeled as tensile and compressive loads. This research investigates the response of an elastic-plastic single-degree-of-freedom system subjected to different explosive loads with different positive durations. The maximum intensity of blast load and blast duration remains constant, and the positive phase duration is the only variable that changes. The nonlinear dynamic responses of a single-degree-of-freedom system (i.e., displacement, velocity, acceleration, and ductility) are calculated using the linear acceleration method. The results show that increasing the positive phase duration and the amount of positive impact can increase the maximum displacement and ductility of the system. Also, it can be concluded that the maximum acceleration of the studied systems remains constant when the values for the blast impact and positive phase durations change.

One of the most important manifestations of love is literature and poetry. In Persian literature, the word love has a special importance and in Plato's thought, love has a high status. Many Indian poets have written precious poems about love, romance, the description of the beloved and the hardships of love; In other words, in most divans of Indian style poets, love is a kind of main theme of poetic themes and themes. Accordingly, the authors of this study intend to study love in the poetry of Safavid poets (Saeb Tabrizi, Talib Amoli, Naziri Neyshabouri, Orfi Shirazi and Kaleem Kashani) based on Plato's thoughts and division of love.

This research is a descriptive method and content analysis in the poems of Safavid poets.

Plato sometimes considers love as the desire to have goodness and sometimes the desire to possess beauty, so Platonic love needs beauty and perfection of the beloved and his love has a human face and can not be an obligatory description of transcendence, therefore it is not common in all universes. On the other hand, this love is a bridge to true love and absolute beauty.

The views of Platonic love can also be seen in the poems of Safavid poets. According to these poets, virtual love is the basis and prelude to achieving divine love and absolute beauty. Therefore, their love also has an epistemological aspect. In general, Indian poets have paid more attention to the reflection of virtual or physical love in their lyric poems. In this context, they talk about the ups and downs of the path of love, about the value and high status of love, as well as about the lover, the pain and sorrow of the beloved, and believe that the lover must go through worldly affairs to reach the beloved. The descriptions of love, lover and beloved in the poems of these poets are in line with Plato's ideas.

The purpose of this article and its main question is to study the stylistic features of the poem "Merat Al-Mahboob" or Yousef and Zulaikha Fakheri Fasaei. Considering the poet's influence on theological teachings and the use of interpretations and religious aspects of the work, this work can be considered first influenced by the Qur'an and then the narrations, Torah and followers of the previous poems of Yusuf and Zulaikha such as Ferdowsi, Jami, Khavari Shirazi, and Azar Bigdeli. In this article, the stylistic features of the work in linguistic aspects, including the three levels of "lexical, phonetic and syntactic" as well as the literary and intellectual level are examined and its proximity to the style of the return period and the intermediate period (constitutionalism) is examined. . Also, the stylistic features of the poet, which are specific to him, are considered and the local language of the poet is also mentioned.

This research has been done with library studies, filing and using analytical-descriptive method.

Fakheri's style of expression in his poems is influenced by the period of return and his language has an acceptable stability. His order is not devoid of the simplicity of the language of the constitutional period (intermediate), and colloquial words are also seen in it.

Fakheri has a personal style, the poet is very interested in some words and repeats them regularly. Has created him among these poets. In general, Fakheri style is a combination of the style of the period of literary return and the period of constitutionalism (intermediate) and his language has the antiquity of Khorasani style and at the same time simplicity and mentality and slang words.

The purpose of this study is to investigate the vegetative and soil characteristics of ‎natural and ‎plantation stands of Nitraria schoberi on the ‎western shore of Lake Urmia. In this study ‎in ‎natural stands of N. schoberi (Jabal Kandi region) 40 plants and in plantation stands of ‎N. ‎schoberi (Jabal Kandi and Seporghan regions) seven transects with unequal lengths (containing ‎‎15 ‎individuals) were randomly selected along the planting rows. The characteristics of total height, ‎collar ‎diameter, large and small diameter of the crown, and the health of seedlings were then measured. ‎In natural stands of N. schoberi, seven soil samples were randomly taken from ‎‎the vicinity of the seedlings. In plantations stands with sampling in each transect, adjacent to the ‎‎first, eighth (middle), and last seedlings of each sample line, soil samples were taken from 0-20 cm ‎‎depth, and after mixing these three soil samples, a sample was prepared, and soil physicochemical ‎‎properties were examined in the laboratory. Results showed that there was a significant difference ‎between the vegetative characteristics of total height (m) and the average crown diameter (cm) of N. ‎schoberi seedlings in Jabalkandi natural stand (7.1±3.0 m and 463.20±0.91 cm) with two other ‎plantation ‎stands, Jabalkandi (99.03±0.0 m and 287.5±87.37 cm) and Seporghan (50.01±0.0 m and ‎‎90.4±50.31 cm). Plantation ‎ and natural habitats of N. schoberi in Jabalkandi region had poor soil ‎fertility, high pH and lighter soil. The results of this study showed that in planting N. schoberi ‎species to control the wind erosion, it is very important to pay attention to the physical and chemical ‎properties of the stand soil, and this species reacts negatively to heavy texture and high amounts of ‎clay.

Abstract. A topological group H is called ω -narrow if for every neighbourhood V of it’s identity element there exists a countable set A such that V A = H = AV. A semigroup G is called a generalized group if for any x ∈ G there exists a unique element e(x) ∈ G such that xe(x) = e(x)x = x and for every x ∈ G there exists x − 1 ∈ G such that x − 1x = xx − 1 = e(x). Also let G be a topological space and the operation and inversion mapping are continuous, then G is called a topological generalized group. If {e(x) | x ∈ G} is countable and for any a ∈ G, {x ∈ G|e(x) = e(a)} is an ω-narrow topological group, then G is called an ω-narrow topological generalized group. In this paper, ω-narrow and resolvable topological generalized groups are introduced and studied

Introduction :

Clutches are widely used in various vehicle powertrains system. Unlike cars, tractors use a dual clutch system for smooth operation of the external power takes off shaft. The dual clutch system allows the operator, while working with an implement, to change gears without affecting on the operation of implement. When the pedal of clutch is fully pushing, the drive was be interrupted in transmission system and PTO shaft. Because the torque of the tractor’s engine is more than the car’s engine, the extra force is be need to hold the tractor’s clutch.The nature of tasks on a tractor, necessitates a number of actions to be performed by the operator, which puts varying physiological demands on his body. Examples of these tasks are: steering of the tractor, looking backward to observe and control the machine/implement, and force required to operate the clutch, brake, and hydraulic control system.This tasks and workplace, was determines the postures and load distribution on the body structures of the operator.Pedals are one of the most important controllers used in vehicles. Dupuis (1995), reported that a driver pushes the pedal of clutch 230 times per hour on average. Lehmann (1958), pointed out, that the force is exerted on the pedal generally is far greater than the required force. If the force exerted on the pedal is high, the driver cannot detect the moment that the clutch is actually released. Forasmuch as, the clutch is operated by a leg force, and it is mounted on the left side of the tractor driver. Then it’s more important to use a mechanism to amplify the force that applied on the clutch by the driver. use a booster is an appropriate way to amplify the force.

Materials and Methods:

 First of all, before installing the booster, the force required for pushing the clutch was calculated. Keeping in mind that no change should occur on the tractor body and pedal position. Then, the booster was installed between the clutch pedal and clutch plug lever. Since the force from clutch to clutch plug lever is tensional, the booster was initially in compression, the direction of the force attached to the clutch was changed using a lever. The direction of resulting force from booster was changed using another lever that to be applied to the clutch plug lever. In order to, providing vacuum for booster, the booster’s vacuum chamber was connected to the engine’s input manifold by a plastic tube. Forty experiments were conducted to calculate the requirement force for pushing the clutch. These experiments were carried out for 5 engine speeds (800,1100, 1400, 1700 and 200 rpm), and 8 inlet diameters of manifold (15, 20, 25, 30, 35, 40, 45 and 50 mm). Experiment was repeated 3 times. Finally, the mean results from three experiments was considered as the true value for each experiment. A load cell (ZEMIC (H3)) was used to calculate the force required for pushing the clutch and data of each experiment was saved in computer distinctively. For measuring the suction in connecting tube that placed between the booster and air manifold, the water column upwelling method was used.

Results and Discussion:

 Results of analysis of variance shows that the interaction effect of inlet diameter × engine speed and force, as well as, interaction effect of inlet diameter × engine speed and suction was significant (P <1%). This means that by increasing the engine speed and decreasing the inlet diameter of manifold, more air is sucked in, and therefore, the pressure inside the manifold was be reduce. by decreasing the pressure in the manifold, the difference pressure on both sides of the booster diaphragm was increased, and cause increasing the auxiliary force of booster, thereby, the force required to press the pedal was reduced. Maximum reduction on the force required to push the pedal by using this system is about 170 N, that occur in 15 mm inlet manifold diameter and 2000 rpm engine speed.

 Conclusion:

 In this paper, a brake booster was installed on the MF285 clutch to reduce the force required to push the clutch pedal. It was observed that this force was about 33.6 kg in the normal state while by using of this system, the required force was reduced to 26 kg.

This study was designed to investigate the use of different levels of soybean lecithin in the Tris extender on semen quality and sex ratio using real-time qPCR technique.

Sampling of 4 Holstien bulls was performed once a week, then the appropriate samples were mixed. Samples of sperm (in 4 replications) were divided into three groups: zero, one and two percentage soybean lecithin. The qualitative parameters and the sex ratio of the semen were determined. Swim up technique was used to wash the semen and remove the dead cells. Moreover, the PLP and SRY genes were propagated to separate the specific fragments of X- and Y- chromosomes sequences. In this procedure, PAR was used as a housekeeping gene to normalize the gene expression data in real-time qPCR.

The results showed that swim up technique and different levels of soybean lecithin improve the semen quality. In addition, swim up technique significantly reduced PLP gene expression (0.75±0.11), against increased SRY gene expression (1.37±0.13). However, using of different levels of soybean lecithin did not change the sex ratio of the sperms.

In general, soybean lecithin is an appropriate substitute to animal sources and improves the quality of semen. Due to the limitations of using animal resources in bull extenders, the use of soybean lecithin as a plant source is suggested.

In the present paper, articial neural networks (ANN)and regression analysis for predicting compressivestrength of cubes of concrete containing silica fume(SF), y ash,Copper slag are developed at the ageof 7,28 days. For building these models, trainingand testing using the available experimental results for66 specimens produced with 6 dierent mixture proportionsare used. The data used in the multi-layer feedforward neural networks models,linear regressionmodel are designed in the format of seven input parameterscovering the age of specimen, cement, ne aggregate,coarse aggregate, y ash, silica fume,copperslag. According to these input parameters, in the multilayerfeed forward neural networks, models are used topredict the compressive strength,durability values ofconcrete. It was shown that neural networks have highpotential for predicting the compressive strength anddurability values of the concretes containing silica fume(SF), y ash,copper slag. Results show that thevalues obtained from the training,testing in ANN-I(LM Algorithm) model are very closer to the experimentalresults. The results show that ANN has strongpotential as a feasible tool for estimating the ingredientsof concrete to meet the design requirements. Also,multiple regression (MR) is a statistical technique thatallows us to predict someone's score on one variable onthe basis of their scores on several other variables. MR isemployed to learn more about the relationship betweenseveral independent or predictor variables,a dependentor criterion variable. Therefore, MR analysis wascarried out using a MATLAB 2013 package to correlatedetermined fc value to the seven concrete parameters.The data used while developing the ANN model (i.e.,66 data sets) were used in the development of the MRmodel. However, the obtained indices make it clear thatthe ANN model is more capable with a higher predictionperformance compared to the MR model.

Ground motions consequent to an earthquake re ect the features of the seismic source, the rupture process, the source-site travel path, and local site conditions. Consequently, the characteristics of ground motion in the vicinity of an active fault can be signicantly dierent from those of the far-eld. Recordings from recent earthquakes show that near-eld earthquakes have dierent characteristics than far-eld earthquakes. Overall, these characteristics are caused by a directivity eect in near- eld earthquakes. This phenomenon causes the fault normal component of the recorded near-fault to have long-period velocity pulses. This paper investigates the relationship between the near-eld of seismic parameters, including range, energy and frequency content parameters, and the results are compared with far-eld earthquakes. 30 records of far and near-eld earthquakes have been used. The data were analyzed by the Pearson correlation coecient. It is a measure of the linear correlation (dependence) between two variables, X and Y, giving a value between +1 and -1 inclusive, where 1 is total positive correlation, 0 is no correlation, and -1 is total negative correlation. The results show that the correlation between the parameters of the horizontal component of near-eld not only has a direct relationship, but that the correlations, on average, are powerful. The results show that maximum velocity of ground motion is better than maximum acceleration in prediction of other seismic parameters in three-components. On the other hand, the relationships between horizontal and vertical components of the parameters of the near-eld dier considerably. So, in the horizontal component, no inverse relationship is seen between the parameters.

In agricultural mechanization projects, operations and practices should be accomplished in a certain sequence as well as in a short time period. Otherwise, the expenses due to the timeliness of the practices will be created. To prevent these expenses, scientific planning of the projects is an appropriate solution. In different industries, project management principles are employed for satisfactory planning. The basic insight in whole approaches is the use of networks. In this research, PERT and CPM networks due to high capabilities have been used as robust tools for planning and timing the carrot production mechanization. In this regard, required data and information were gathered. The project activities were determined and WBS was drawn. Finally, PERT and CPM networks related to the project were illustrated and analyzed. Results showed this project has 25 critical paths and the earliest time to complete the project is 187.5 days and the variance and standard deviation values were 26 and 5.09, respectively. The model of the present network is capable to answer statistical questions and provide a bright insight for the project manager to make timely decisions. Consequently, the mechanized carrot production project goes ahead as programmed with high productivity.

Measuring the resistance and fracture force of materials is a basic and fundamental issue in designing of many agricultural equipment and machinery. In this study, the fracture force of four varieties of safflower seed cultivated in Iran at moisture content of 5.5% (w.b.) in both horizontal and vertical positions were determined. In the experiments a grain pressure test device (Instron) was used. The results showed that in horizontal loading position, the maximum fracture forcebelongs to Padideh variety (83 N) and then Goldasht variety (80.29 N), while the minimum fracture force belongs to Esfahan 28 variety (65.64 N). At vertical loading position the maximum and minimum fracture forces belong to Goldasht variety (50.74 N) and PS variety (34.64 N). By comparing the effects of loading positions (horizontal and vertical), the fracture force values for Goldasht variety are significantly more than those for other varieties. Therefore, Goldasht variety is preferred to other varieties because of its highest strength against mechanical damages. In all varieties, the fracture force of the seeds in horizontal loading position was about twice as much as in vertical loading position.