جستجوی مقالات مرتبط با کلیدواژه « N balance » در نشریات گروه « علوم دام »

Crude protein is a key element in regulating the diet of ruminants and is considered one of the most expensive nutrients needed by livestock. Feeding management plays an important role in the elimination of nitrogen in the production environment and the emission of greenhouse gases in animal husbandry systems (Avathar et al 2021). When there is excessive discharge of nitrogen in the environment, it causes the ecological balance in surface waters to be disrupted and the groundwater to be polluted (Dijkstra et al 2011). Excretion of these compounds in the environment will increase with fermentation, digestion and inefficient metabolism, and the increase in inefficiency in the rumen is caused by the complex and competitive metabolic pathways in the rumen microbial population. Therefore, increasing efficiency in the use of nutrients, especially nitrogen, to minimize their excretion from the animal's body should be considered. Various methods can be implemented in an animal husbandry unit to improve the use of nitrogen in ruminants. One of these solutions is to reduce the crude protein in the diet, but it has been reported that this method can have a negative effect on animal production (Chibisa and Motswangwa 2013). Another solution is nutrient synchronization or synchronizing the fermentation rate of dietary protein and energy sources, which has led to limited success (Yelchi et al 2020). Another solution is to create oscillating in the concentration of crude protein in the diet and feed it intermittently at intervals of one to three days, and previous reports show that this method has improved nitrogen retention and its utilization in the body compared to eating constant amounts of crude protein daily in sheep and cattle (Rach et al., 2021). This study was conducted in order to investigate the effect of constant and intermittent feeding of dietary crude protein on ruminal parameters and microbial protein synthesis in sheep.

Three diets were adjusted with 12, 14 and 16% crude protein but with the same metabolizable energy and protein. 8 male sheep were used in metabolic cages in a 4x4 Latin square design (four treatments with 2 squares and 8 replications). The first treatment received a diet with a crude protein level of 14% constantly. The second, third and fourth treatments received diets with 12 and 16% crude protein at intervals of 24, 48 and 72 hours, respectively. Nitrogen balance and retention, rumen and blood parameters, volatile fatty acids and microbial protein synthesis were measured.

The lowest total excreted nitrogen (via urine and feces) was observed in the treatment with 48-hour raw protein consumption interval (P=0.031). The retained nitrogen showed a significant increase in this treatment as compared to the constant crude protein feeding treatment (P=0.045). It has been reported that the increase in nitrogen retention in ruminants that received diets with oscillating crude protein levels is due to increased urea recycling in the rumen (Cole, 1999). It seems that the transfer of urea from the blood to the rumen during the consumption of diets with low crude protein level (times 24, 48 and 72 hours) in oscillating diets increased and it compensates for the shortage of nitrogen in the rumen. In this condition, nitrogen excretion through urine also decreases and the efficiency of nitrogen use increases. The highest rumen liquid ammonia nitrogen was observed in the treatment with 48-hour crude protein consumption interval, but the pH and concentration of volatile fatty acids did not show any significant difference among the experimental treatments. Comparing the treatment of constant crude protein feeding (14%) with the treatments with intermittent consumption of crude protein (12 and 16%) in terms of the concentration of volatile fatty acids in the rumen fluid of the experimental sheep, including acetate, propionate and butyrate, as well as total volatile fatty acids, there is not a significant difference. The same ratio of concentrate to fodder and the similarity of the feed ingredients in the diets can be a reason for the lack of significance between the experimental treatments, which is in line with the results of previous researches (Khattab and Abdulwahid, 2018). A significant difference was observed between the experimental treatments in terms of allantoin, total purine bases excreted, as well as nitrogen and microbial protein production, and the treatment with oscillating consumption of raw protein at a time interval of 48 hours had the highest amount. Albumin and total blood protein measured between the experimental treatments showed no significant difference, but blood urea nitrogen was the highest in the treatment with 48-hour crude protein consumption interval (P = 0.005). Microbial protein synthesis in the rumen is affected by many animal and dietary factors, including nitrogen amounts, nitrogen sources, carbohydrate and nitrogen degradation rates, type and amount of carbohydrates in the diet, dry matter consumption, stability of fermentation in the rumen, and synchronization between nitrogen and energy (Hall 2013). It seems that in diets that cause fluctuation in the entry of protein sources into the rumen, the recycling of nitrogen to the rumen is done more effectively through the blood vessels and the liver, which in addition to reducing the excretion of nitrogen from the body also increases the production of microbial protein, in other words, the efficiency of using feed nitrogen increases, which is evident in the results of this research.

The results showed that using the strategy of oscillating dietary crude protein concentration in sheep's diet improves nitrogen retention, rumen fermentation activities and microbial protein synthesis.

Introduction :

 The fodder used in animal feed is in the form of silage, crushed and pellets. If used a a pelleted form, the animal will spend less time for eating so the activity and the maintenance requirements will be decrease. Part of the improvement in pellet diet is due to less energy consumption during feeding. In other words, the use of pellet rations reduces the energy consumed by the animal for eating and also increases the availability of vital nutrients and energy (Fluharty et al., 2017). Alfalfa is one of the forage plants that can produce more than two tons of protein per hectare per year. Pelleted alfalfa is a perfect feed for dairy cows, sheep and goats, horses, camels, rabbits and other livestock animals as it improves their performance and production (Fluharty et al., 2017).The activities of ruminal protozoa contribute significantly to the digestion of plant cell wall polymers and their absence from the rumen may have a negative effect on the extent of fiber digestion. Fiber-degrading enzymes include total cellulase activity, carboxymethylcellulase, and microcrystalline cellulase. The activity of these enzymes is in three separate parts of the rumen contents, including tiny particles (microbes attached to the rumen particle), intracellular part (cells that are freely suspended in the liquid part of the ruminal fluid) and extracellular part (enzymes in the liquid part) are measured (Agarwal et al., 2000). The aim of this study was to investigate the effect of alfalfa physical shape and barley grain processing on nitrogen retention, activity of enzyme cellulolytic, blood parameters and rumen microbial population in Dalagh breed fattening lambs.

Thirty male lambs with an approximate age of 3.5±1.2 months with an average weight of 17 ± 1.1 kg were used. The experiment was statistically analyzed in the form of a factorial experiment based on a completely randomized design with two factors. The experimental variables include: physical form of forage (chopped vs. pelleted form) and barley grain processing (whole vs. grounded vs. steam flaked). The experiment was performed in the 98 days (14 days of habituation and 84 days of the main course) with 6 treatments and 5 replications. Experimental diets were equal in protein and energy content and includes: 1- Pelleted alfalfa with whole barley grain 2- Pelleted alfalfa with ground barley grain 3- Pelleted alfalfa with flaked barley grain 4- Alfalfa with whole barley grain 5-Alfalfa with ground barley grain 6 -Alfalfa with flaked barley grain. Rumen fluid was sampled on day 84 at 3 hours after feeding and blood samples were taken from the lambs in the penultimate week of the fattening period 3 hours after morning feeding from the cervical vein.

Nitrogen consumption and fecal extracted nitrogen in lambs feces were significantly affected by the physical shape of the forage, which nitrogen consumption and fecal nitrogen excretion in lambs fed with pelleted alfalfa compared to chopped alfalfa were increased (P<0.05).  The processing of barley grain didn’t significant effect on apparent nitrogen balance parameters (P>0.05). The total number of rumen bacteria, lactic acid, coliform and rumen protozoa were not affected by the physical form of the forage (P >0.05). However, the number of total bacteria and rumen protozoa in lambs fed with flaked barley grain were higher than milled barley grain and also in milled barley grain were greater than whole barley grain (P<0.05). Activity of carboxymethyl cellulase and microcrystalline cellulase enzymes in intra cellular, extra cellular, solid and total rumen fluids of lambs fed pelleted alfalfa forage and flaked barley was higher than chopped alfalfa, however, there was no significant difference between treatments (P >0.05). The blood glucose of lambs was significantly higher in lambs fed by flaked barley than milled barley and in milled barley was higher than whole barley grain (P<0.05) The blood urea nitrogen of lambs was significantly lower in lambs fed by flaked barley than milled barley and in milled barley was lower than whole barley grain (P<0.05).

The results of our experiment showed that the use of pelleted alfalfa and flaked barley grain in the diet of fattening of lambs due to numerical increasing trend in digested nitrogen, statistical reducing of urea nitrogen and numerical increasing trend in total rumen bacteria and cellulase enzymes activity had the best performance of rumen, which ultimately ensures the health of livestock. For recommendation using pelleted form of forage and flaked barley grain for farmers is required more study to investigate rumen and post rumen digestion rate of nitrogen and also, the cost of processing. While the lamb performance increase compared to the cost of processing, it can be recommended to the farmer to instead of consuming alfalfa and barley grain as a traditional way, use the processed form of them to improve the efficiency of the use of nutrients and increase the performance of the animals.

The aim of this study was to evaluate the effects of CLA supplementation in diets with different levels of forage NDF on performance, serum metabolites and liver functionality in Holstein fresh cows. Forty Cows were blocked based on their body condition score at calving and 305-d mature-equivalent milk yield, and randomly allocated to 1 of 4 experimental diets from calving to 21 days in milk (DIM). Treatments were used in a 2×2 factorial arrangement with 2 levels of fNDF and 2 doses of CLA supplement; Treatments were formulated to contain 18.0 or 23.0% fNDF without or with CLA supplement for diets 18fNDF-CLA, 18fNDF+CLA, 23fNDF-CLA and 23fNDF+ CLA. There was no effect of fNDF by CLA interaction on investigated items. Dry matter intake increased up to 1.5 kg with 18fNDF diet compared to 23FNDF (P<0.01), while the addition of CLA reduced the dry matter intake to 1.15 kg/d compared to diets without CLA supplementation (P<0.01). Cows fed 23fNDF diet lost more body weight than those fed 18fNDF. Milk yield was higher for cows fed 18fNDF than 23fNDF (P<0.01). Cows fed diets containing CLA produced more milk, lower milk fat percentage, and higher lactose content. (P<0.05). Serum glucose was higher in cows fed CLA-containing diets (P<0.01). Cows fed 18fNDF had lower serum concentrations of NEFA and BHBA compared to those fed 23fNDF (P<0.05), but CLA supplementation did not affect serum NEFA and BHBA (P>0.05). (P<0.05). In general, the reduction of forage NDF in the diet of fresh cows led to improved feed intake and production performance. Addition of CLA to the diet of fresh cows led to glucose savings by reducing fat synthesis, increasing lactose content and milk production.

The aim of this study was to determine energy requirement for maintenance (MEm) and to estimate efficiency of energy utilization for gain (kg) using comparative slaughter technique (CST) and relative growth index (RGI: gain/BW0.75) in growing turkey chicks from one to four kg of live body weight (LBW). Forty male turkey chicks (24 days of age, 800 ± 93 g LBW) were fed a standard diet (12.3 MJ ME) up to 4 kg of LBW. Apparent metabolizable energy (AME, and AMEn), nutrient digestibility of the diet, and energy balance were determined at two and three kg of BW. In CST, twenty chicks were randomly killed at four stages (five birds at each stage) at 1119 ±60, 2539 ±93, 3528 ±68, 3957 ±82 g of body weight, and the chemical composition of carcass were measured. Maintenance energy requirement (MEm) and efficiency of energy utilization for gain were determined by linear regression in CST. In RGI, the MEm and energy for growth were estimated by a regression of ME intake and relative daily gain. The results showed that in CST, MEm and efficiency of energy utilization for gain were 450 (kJ/kg BW0.75/d), and 56% respectively. In RGI, the MEm and energy for growth were 3.66 (kJ/g BW0.75/d), and 10.4 kJ per g gain. In conclusion, using RGI method is recommended to estimate energy requirement for maintenance and growth in growing turkey due to its simplicity.

The alimentary tract microbial community, is effective on energy efficiency in the host, including energy intake, transport, conversion, and storage. The term “probiotics” has been amended by the FAO/WHO to “Live microorganisms, which, when administered in adequate amounts, cause a health benefit on the host”. Animal nutritionists always try to maximize production efficiency of dairy cattle. Using various additives in animal ration is a common and popular approach to increase yield and production efficiency. Application of antibiotics in diets has proven to be effective tools for improve energy retention and reduce nutrient losses in ruminant animals. However, many countries concern regarding use of antibiotics in animal feed industry. Then, researchers try to find other non-antibiotic alternatives to manipulate rumen fermentation in order to reduce energy and nutrient losses and improve nutritional value of diets. In the last years, use of direct-fed microbial as a feed supplements have been studied in many countries around the world. Saccharomyces cerevisiae is a commonly used direct-fed microbial supplementation in dairy cattle ration. Although improve in milk production, milk fat synthesis, rumen pH, ratio of propionate to acetate and fiber digestibility has been seen in some experiments, However, dairy cattle have been shown different responses to Saccharomyces cerevisiae supplementation in their feed. Then, the current study was carried out to evaluate the effect of probiotic (Saccharomyces cerevisiae) on milk yield and composition, feed intake, production efficiency and blood parameters of high producing multiparous Holstein lactating cows.  Twelve multiparous Holstein dairy cows with average daily yield of 35 kg and 110 days in milk were used in this study. Experimental period length was 28 days including 21 d for adaptation period and the last 7 d for sample taking and data recording. Dietary treatments consisted of 1) control (ration without probiotic) and 2) diet containing 6 g/d probiotic (Saccharomyces cerevisiae) that fed as ad libitum. Diets were equal in terms of protein, net energy for lactation and neutral detergent fiber. During experimental period, milk yield was recorded on d 14, 21 and 28 of trial and were sampled to evaluate milk composition such as protein, fat, and lactose using milkoscan set. Feeds and orts were weighed daily from d 21 to 28 to determine the feed intake of animals. To assess biochemical blood parameters, each cow was bled via vein 2 hours after morning feeding at the last day of trial. Blood samples then were centrifuged at 4 ºC and 1850×g for 20 minutes. Then, serum was analyzed for glucose, insulin, calcium, phosphorus, urea nitrogen, high density lipoprotein, low density lipoprotein, cholesterol, triglyceride and non-esterified fatty acids using kits. Data were analyzed as a completely randomized design using the MIXED procedure of SAS.  Results showed that dietary inclusion of yeast (Saccharomyces cerevisiae) had no effect on dry matter intake of animals as compared to control group. However, dry matter intake was numerically higher in animals fed Saccharomyces cerevisiae due to acceleration in fiber digestion and consequently higher passage rate. Milk yield was increased (P<0.01) in cows fed Saccharomyces cerevisiae when compared to control group. Moreover, feed efficiency was not affected by dietary treatments. Similarly, supplementation of 6 g/d Saccharomyces cerevisiae noticeably increased (P<0.01) milk fat percentage and tended to decrease (P=0.06) milk urea nitrogen concentration due to lower blood urea nitrogen in this group. However, milk protein and lactose percentage were not affected by inclusion of 6 g/f Saccharomyces cerevisiae in diet. Furthermore, dietary supplementation of Saccharomyces cerevisiae led to an increase in blood serum glucose (P<0.01), cholesterol (P<0.05), calcium (P<0.01) and phosphorus (P<0.01) concentration and a decrease in blood urea nitrogen (P<0.05) concentration in Holstein lactating cows. Also, dietary inclusion of Saccharomyces cerevisiae tended to increase blood serum insulin (P=0.08) and high density lipoprotein (P=0.05) concentration and tended to decrease non-esterified fatty acids (P=0.06) concentration in dairy Holstein cows.  In general, results of this experiment indicated that dietary inclusion of 6 g/d of Saccharomyces cerevisiae caused an improvement in milk yield and milk composition of dairy Holstein cows. Moreover, improvement in blood glucose, high density lipoprotein, cholesterol, calcium and phosphorus concentration and reduction in non-esterified fatty acids in response to Saccharomyces cerevisiae might lead to better reproduction performance and prevention some metabolic disease (e.g. ketosis and fatty liver) of high producing dairy cattle.

The main protein degradation product in ruminant is urea. The urea synthesized in liver and lost to the environment via urine and feces. However, there is mechanism in ruminants to recycling 40 to 80% of hepatic urea-N output to the gastrointestinal track (GIT). During the process of urea nitrogen salvaging (UNS), urea entry into the ruminant gastrointestinal tract via facilitative urea transporters. The passage of urea across cell membranes is facilitated by such transporters then the urea descends a concentration gradient and derived from two separate genes: SLC14A1 (UT-B) and SLC14A2 (UT-A). There is a chance for controlling of urea-N recycling to the GIT, via manipulating the dietary factors such as level and type of dietary crude protein that affect urea transporters-B expression. However changes in urea transporter expression in the rumen tissue of ruminants in response to dietary changes have not fully understood. Hence our hypothesis was that changes in the type of dietary protein sources and the level of dietary crude protein, are important because they determine how much N is directed toward ruminal NH3-N (25). This study aimed to show how concurrent alters in dietary protein sources and crude protein change nitrogen efficiency and ruminal UT-B expression in Baluchi male lambs.
Four Baluchi male lambs (30 ± 2 kg BW) were used in a 4 × 4 Latin square design with 28-d periods (adaptation: 21 d and sampling: 7 d) and a 2 × 2 factorial arrangement of dietary treatments. Lambs had free access to clean water over the experimental period. The dietary factors studied were: 1) canola meal vs. canola meal with fish meal as the principal source of protein; and 2) dietary levels of crude protein of 16 vs. 18%. Treatments were offered to the animals twice daily for ad libitum intake (09:00 and 16:00 h). The DM, OM, and N contents were determined according to the AOAC. Volatile fatty acids were separated and quantified by gas chromatography. Ruminal NH3-N was determined using distillation method. Total N in pooled urine was determined using the macro-Kjeldahl procedure. For UT-B gene expression analysis, total RNA was extracted via High Pure RNA Isolation Kit, followed by digestion with RNasefree DNase. About, 1 µg of RNA was used to generate first-strand cDNA using cDNA Synthesis Kits. Gene transcript abundance was quantified using real-time quantitative PCR using SYBR Green fluorescence detection. The primers used for urea transporter-B (UT-B) and ovine glyceraldehyde 3-phosphate dehydrogenase (ovine GAPDH; NCBI Accession No. BC102589) were previously reported. Ovine GAPDH was used as an internal reference to normalize UT-B mRNA expression. Briefly, the PCR primers were UT-B (forward, 5′/ggacctgcctgtcttcactc/3′; reverse, 5′/gatcaaggtgcttgggaaaa/3′) and ovine GAPDH (forward, 5′/gattgtcagcaatgcctcct/3′; reverse, 5′/ggtcataagtccctccacga/3′) with amplicon size of 97 and 94 bp, respectively. Amplification conditions for ovine GAPDH and UT-B included a predwell for 3 min at 95 °C and 35 cycles of denaturing for 30 s at 95 °C and annealing for 30 s at 58 °C. The real-time qPCR reaction mixture used for each gene consisted of 12.5 μL of Maxima SYBR Green qPCR Master Mixes, 0.5 μL of each primer (25 μM), and 1.0 μL of template cDNA, made up to 25 μL. The amplification efficiency was 100.1%.
Result and Disscusion: Lambs fed CM have greater nutrients intake, significantly. Crude protein level had no significant effect on nutrients intake except CP intake. Nutrients digestibility was not affected by treatments, CP content and dietary protein sources. Ruminal pH, VFA concentration and acetate to propionate ratio were not influenced by the experimental diets and dietary protein sources. Significant differences were observed for NH3-N and BUN concentration in lambs fed treatments contain 18% CP compared to the lambs fed diets contain 16% CP. Both of CP content and dietary protein sources had significant effect on N intake and urinary N excretion. Nitrogen intake and urinary N excretion increased as dietary CP level increased. Lambs fed CM have greater N intake and urinary N excretion, significantly. Fecal N excretion was not affected by treatments, CP content and dietary protein sources. Lambs received CM diets had higher apparent N balance. Expression of urea transporter-B mRNA (expressed as copies/copy of ovine GAPDH) was not affected by treatments. Also, dietary CP content and dietary protein sources could not impact on the expression of UT-B mRNA.
Our finding suggest in studing of manipulating the expression of UT-B mRNA, both dietary factors such as dietary crude protein level and type of protein sources and ruminal factors shch as intra and para cellular pH should be considered.

This experiment was carried out to investigate the effects of starter period’s (1 to 10 d) dietary cation-anion balance on performance, tibia bone mineralization, serum electrolyte level, carcass characteristics and small intestine morphology. A total of 280 day-old broiler chicks of Ross 308 strain were used in a completely randomized design. Treatments consisted of five different level of dietary cation-anion balance (150, 200, 250, 300, and 350 mEq/Kg) and each of them replicated four times (14 birds per replicate). The results showed that feeding a diet with anion-cation balance of 350 mEq/Kg, significantly (P0.05) effects on tibia bone ash content, but significantly (P

Apparent digestibility of dry matter (DM), organic matter (OM), crude protein (CP), neutral detergent fiber (NDF), crude fat, non-fiber carbohydrate (NFC) and total digestible nutrient (TDN) date by-products (included seed, pulp and lerd) were studied in this experiment. Also, Nitrogen balance of these by-products and their effects on blood parameters were determined. Six Raini mature goats (4-5 years and 45±3 kg BW), were used in a changeover design with six replicates (goats) and three periods was used. Every experimental period lasted 21 d including 16 d of adaptation to the experimental diets and 5 d for collection of samples. The animals were housed in individual metabolic cages equipped for separate collection of urine and faeces. Alfalfa digestibility was determined at the beginning of the experiment. Experimental diets were formulated to contain 60% alfalfa and 40% date by-products and fed to the animals about 40 g/w0.75. In this study, Digestibility of DM, OM, crude fat and TDN of seed and pulp were significantly higher than lerd (P<0.05). Blood parameters in goats fed these by-products were not statistically significant. In conclusion, using date seed and pulp compared with lerd showed better digestion coefficients. However, because of low protein content of these by-products, supplementing these diets with protein sources is recommended.

In this study، we determined the effects of replacing different levels of alfalfa with Pistachio Hull (PH) on feed intake، digestibility of nutrients، rumen fermentative parameters، blood metabolites and nitrogen metabolism in Balochi male lambs. Three male lambs (35±2 kg live weight) equipped with ruminal and abomasual cannulas were randomly assigned into a 3 × 3 Latin square design. Experimental diets included 1) 30% alfalfa، 20% wheat straw، 50% concentrate (DM basis) and in 2 and 3 diets the 15 and 30% of alfalfa was replaced with Pistachio Hull، respectively. Result showed that feed intake was not different between treatments. Total tract digestibility for DM، OM، ADF and NDF were not significantly affected by the diets، but CP in total tract was significantly decreased. Dietary PH content resulted in a decrease in the rumen N-NH3 concentration. The concentration of liver enzymes، cholesterol، HDL، LDL and VLDL were not influenced by PH content of diet. As tannin was increased in the diets، the nitrogen intake، nitrogen excretion from urine and digested nitrogen significantly were decreased. Nitrogen excretions from fecal were significantly increased by increased of dietary tannin. Therefore، using of PH in level of 30% (DM basis) due to supply appropriate levels of tannin without negative effects on feed intake and nutrient digestibility، can improve animal performance and with increasing nitrogen excretion from urine to feces environmentally can be very beneficial.

This research was conducted to study the effect of heat-processed broiler litter (BL) in roughage based diet on the nutrients intake، microbial protein synthesis and nitrogen balance in sheep. In a completely randomized design، with four treatments (diets) and four replicates، 16 Moghani male sheep، with 63±2. 3 kg live weight، were allocated to four experimental diets including: control diet (mixture of wheat straw and alfalfa، 35:65 ratio)، and experimental diets; 1، 2 and 3 contained 80، 160 and 240 g BL (dry matter basis)، respectively. Results showed that average dry matter intake were 1200، 1506، 1735 and 1601; organic matter intake were 1082، 1350، 1541 and 1420 g/animal/d for the control and experimental diets 1، 2 and 3 respectively، that were significantly increased (P<0. 05) by inclusion of BL in the diet. The daily intake of ash free-neutral detergent fiber and crude protein intake were the lowest (respectively 624 and 123 g) for the control diet، whereas these variables were the highest (850 and 224g respectively) for the animals received 160 g/kg BL diet (P<0. 05). The total urinary purine derivatives excretion، microbial protein production and nitrogen retention were respectively 7. 10، 34. 50 and 5. 50 g/animal/d for the control diet but there were 9. 60، 47. 70 and 13. 30 g/animal/d for the diet contained 160g/kg BL that ranked the highest amounts (P<0. 05) between all diets In conclusion، supplementing roughage based diets with 160 g/Kg of BL could improve the nutrients intake and nitrogen metabolism in sheep.

To evaluate the effects of different dry period lengths on milk yield, milk composition, reproductive performance and energy balance in dairy cows, 30 Holstein breeds (average 270 days pregnant) were made use of in a randomized complete block design. Cows were assigned to three treatments (60, 45 and 30 days of dry period) and two blocks as based on parity (either first lactation or multifarious cows). Milk production and composition as well as somatic cell counts of cows with 45 and 30 days of dry period were not significantly different from cows with 60 days of dry period (P>0.05). Body condition score changes after calving for 60, 45 and 30 days of dry period (1.06, 0.93 and 0.68, respectively) were significantly different. The smallest change in body condition score was observed for 30-day dry period ones, which also had a lower blood concentration of non-esterified fatty acids before calving (364.8 vs 394.9 and 390.9 µEq/l for 45- and 60-day dry periods). Mean days to first postpartum ovulation were 27.9, 27.8 and 22.7 days for dry periods of 60, 45 and 30 days, respectively (P<0.05). Fewer numbers of services per conception was recorded for 30- day dry periods compared with 45- and 60- day dry periods (1.5 vs 2.1 and 3.75, respectively). Cows with 30-day dry periods as experienced fewer number of days in negative energy state in comparison with 60- and 45-day dry periods, which amounts to a better reproductive performance.

In this study, about 1000 kg of wet Rose Flower pulp were obtained from Ghamsar – Kashan in Iran and dried in air for 10 days. The DM, CP, Ash, EE, total extractable phenols, total tannin, Ca and P of Rose flower extraction pulp (RFEP) were 96.0, 12.5, 6.5, 1.8, 2.7, 1.3, 1.1 and 0.1 percent, respectively. Four adult Chaal sheep in a changeover design used for determination of digestibility, dry matter intake and nitrogen balance. The sheep fed by four diets with different ratio of RFEP: alfalfa (0.0:100, 15:85, 30:70 and 45:55). Digestibility of DM and OM were not affected by experimental diets. Inclusion of 30 percent or more RFEP, decreased CP digestibility (P< 0.05). Dry matter intake was not affected by inclusion of different levels of RFEP in diets. The nitrogen balance of diets including zero, 15, 30 and 45 precent RFEP were 3.1, 2.6, 1.4 and 1.1 gram per day, respectively (P< 0.05). The DM and CP effective degradability of RFEP were 68.5 and 67.8, respectively. It seems that Rose flower extraction pulp can be used as a part of roughage in the ruminant’s diet.