b. navidshad

The supplementation of selenium in animal nutrition is useful after a decline in performance due to selenium deficiency of diet. As nutritional technologies progress, new Selenium supplements such as nano selenium are available, which requires research and comparison with previous products. Thus, the aim of this study was the evaluation of selenium sources effect on performance, blood metabolites and immune response in Holstein and Holstein- Mont Bilyard Hybrid calves.

24 sucking Holstein and Holstein-Mont Bilyard calves with mean body weight of 43±1 kg were divided in a completely randomized design for 75 days. The experimental treatments included: 1- basal diet without supplementation of selenium for Holstein-Mont Bilyard calves, 2- basal diet without supplementation of selenium for Holstein calves, 3- basal diet+0.3 mg/kgDM supplementation of nano-selenium for Holstein-Mont Bilyard calves, 4- basal diet+0.3 mg supplementation of nano-selenium for Holstein calves, 5 - Basal diet + 0.3 mg/kgDM Sodium selenite for Holstein- Mont Bilyard calves, 6- basal diet + 0.3 mg/kgDM sodium selenite for Holstein calves. The daily feed intake of calves and body weight gain and the concentrations of metabolites such as glucose, urea, triglyceride, cholesterol, total protein, glutathione peroxidase enzyme activity and the percent of lymphocyte, neutrophil and monocyte of blood samples were determined.

There was no significant effect on performance and also on blood glucose, cholesterol, triglycerides, urea and immune response in calves. But blood total protein and glutathione peroxidase activity increased in calves. In general, the source of supplements was not effective in the level of glutathione peroxidase activity of treatments.

There was no significant effect on performance and blood parameters of Holstein and Holstein-Mont Bilyard calves.

This study was conducted to evaluate the effect of Aloe vera gel and conjugated linoleic acid supplement feeding on performance, blood metabolites and immune parameters in Holstein calves in a completely randomized design with a 2×2 factorial arrangement. This study was carried out using 24 male and female Holstein calves (with average age of 1-10 days and 38±8 kg weight) with four treatments and six replications for 60 days. The treatments were: (1) basal diet including starter and whole milk (control), (2) basal diet + 250 mg/kg body weight Aloe vera gel, (3) basal diet+20 g/kgDM complementary conjugated linoleic acid (CLA) and (4) Basal diet+250 mg/kg body weight Aloe vera gel+20 g/kgDM of CLA. The Dry matter intake, weight gain, feed conversion ratio, blood parameters and immune and health factors were measured. Results showed that there were no significant differences between the control and other groups in terms of feed intake and performance of Holstein calves. The interaction effect of Aloe vera gel and CLA was significant on blood glucose concentration and calves receiving 250 mg Aloe vera gel had the lowest glucose concentration (88.33 mg/dL) (P>0.05). On the other hand, the effect of time on white blood cell, lymphocyte and monocyte was significant (P<0.05) and using 20 g CLA increased blood monocyte (5.33%) compared with no CLA treatments (3.58%; (P<0.05). In general, the interaction effect of aloe vera gel and CLA supplementation was not significant on performance and health status of Holstein calves.

Neuropeptide Y (NPY) is a neurotransmitter that presents at high concentrations in the hypothalamus. Neuropeptide Y is one of the most abundant peptides in chicken's brain, which works as a neurotransmitter in many functions and behaviors. The first time, it was extracted from the pituitary hypothalamus of pigs. This neuropeptide stimulates appetite and affects reproductive hormones. It was showed that there is a significant association between NPY gene and growth and reproductive traits of animals. The aim of this study was to investigate NPY gene polymorphisms and their association with reproductive traits in indigenous turkeys of Iran. These traits were including total egg weight production, length of laying period, age at the first egg, and the weight of the first egg.

A hundred and twenty turkey hens were randomly chosen from turkey’s breeding center of East Azerbaijan of Iran. They were recorded for the reproductive traits. The blood samples of the birds were taken from their wing veins and used for DNA extraction. DNA was isolated from each animal's blood samples using salting-out method (Miller et al 1999).A fragment of 725bp of NPY gene was amplified using designed specific primers. The forward and reversed primers were GAAGCGTACCCCTCCAAAC and CCCCTTTAAGCAGCACAGTC, respectively. PCR was performed in a final volume of 25 ml containing 2ml of DNA template, 1.2 ml of each primer, 8.1 ml water and 12.5 ml master mix containing: dNTP, proofreading Taq polymerase, MgCl2, and 1x PCR buffer. Thereafter, the PCR was programmed as follows: an initial denaturation step at 94°C for 5 min, followed by 32 cycles of 94°C for 60 s, 56° C for 40 s, and 72°C for 45 s. A final extension step was performed at 72°C for 8 min. Electrophoresis of the amplicons was carried out on 1.5% agarose gels, and the gels were visualized under ultraviolet light after 45 minutes in 85 Volt. It should be noted that PCR products were purified and sequenced by Bioneer Company. The polymorphisms of the NPY gene was identified by commercially sequencing the PCR products and aligning the sequences using BioEdit software. PopGen32 software was used to identify genotype and allele frequencies. The associations of polymorphisms or haplotypes with the traits were analyzed using the SAS GLM procedure. Multiple comparisons of Tukey’s test were performed to find differences among means.

The results revealed four novel SNPs in the NPY gene, which has not been already reported in turkey. The detected polymorphisms were including T360G, C367A, T544A, and C552T. Results of statistical analysis showed that there was a significant association between T360G and total egg weight. The T allele was the favorable allele for total egg weight trait as the TT genotype significantly increased the weight of produced eggs. The polymorphism of A544T was significantly associated with egg weight and laying length. The AA genotype of A544T positively influenced both egg weight and laying length traits.  Both SNPs were located in the intron region of the gene. Although intronic mutations are not capable of altering the synthesized protein structure and/or changing the function of the protein, they may affect the level of gene transcription. Additionally, it was proved that the intronic polymorphisms may affect the gene expression levels via influencing the splicing process. Several studies have already been revealed that the NPY gene polymorphism, especially on the promoter and 5'-UTR regions, affect the reproductive traits of chicken. There is another study that reported a significant association between the SNPs of intron 3 of the NPY gene with growth and body traits in cows. It has been proven that NPY neuron terminals directly end on GnRH neurons and NPY is synthesized prior to the release of GnRH. It then releases the follicular stimulating hormone (FSH) and the luteinizing hormone (LH) from the pituitary gland. It has been shown that NPY influences GnRH secretion via affecting Kisspeptin neurons, which consequently alter reproductive traits. Also, stimulating the secretion of the GnRH through the neuropeptide receptors can lead to early maturity in the chicken. On the other hand, it was revealed that stimulation of NPY neurons mediates an increase in energy intake and storage. Altering the NPY gene expression in the hypothalamus of birds resulted in changing energy status. Moreover, NPY has been shown to be a potent appetite stimulating agent in chickens. Specific NPY receptors (Y1 and Y5) have been reported to mediate NPY effects on feeding behavior in chickens. In order to continue laying eggs, turkey hens need a higher amount of available energy and nutrients. Investigations in humans also represented that polymorphisms in NPY influenced fatness in men and was linked to body weight, BMI, body fat prototype, and leptin levels (Ding 2005, Van 2006). Concentrations of NPY are prominent when body fat reservoirs are fully consumed, resulting in hunger enlargement (Kalra et al. 1991). Consequently, upon negative energy balance, NPY levels are anticipated to be elevated. In addition, NPY has been recognized as a major controller of leptin action in the hypothalamus, affecting the discharge of LH and somatotropin (Kalra et al. 1991). This study has pointed out considerable relationships among leptin and NPY SNP with vital intensification, fertility, and milk production characteristics (Clempson et al. 2010). Also, it is assumed to be the cause of augmenting body mass index (BMI) in two different Swedish statistical groups of normal and fat peoples (Ding et al. 2005). The -880I/D advocate region variant of NPY might impact body fat prototyping in non-obese Mexican Americans from Starr County (Bray et al 2000). Therefore, effect of NPY on appetite may influence the supply of nutrients and energy to be consumed for reproductive performance specially egg production traits.

In conclusion, four novel polymorphisms were detected in intron 1 of Meleagrine NPY gene. The polymorphisms of the NPY gene may affect some of egg production traits. If these effects validate by investigating them in a larger or another turkey population, they can be considered in breeding programs of native turkey population in North-West of Iran.