به جمع مشترکان مگیران بپیوندید!

تنها با پرداخت 70 هزارتومان حق اشتراک سالانه به متن مقالات دسترسی داشته باشید و 100 مقاله را بدون هزینه دیگری دریافت کنید.

برای پرداخت حق اشتراک اگر عضو هستید وارد شوید در غیر این صورت حساب کاربری جدید ایجاد کنید

عضویت
فهرست مطالب نویسنده:

m. nazari

  • مریم نظری، حمیدرضا بهاروندی*، ناصر احسانی

    نقاط کوانتومی گرافن عضو جدیدی از خانواده کربن ها می باشد که به دلیل برخورداری از خواص بی نظیر آن، کاربردهای بسیاری یافته و به سرعت در حال توسعه می باشند. هدف از این تحقیق دستیابی به این نانو ماده ارزشمند با استفاده از روش تولید راحت، سریع و آسان تحت عنوان کربوره کردن می باشد. بدین منظور ابتدا تولید از منبع اولیه گلوتامیک اسید در دماهای 210، 220 و 230 درجه سانتی گراد و زمان های 60 و 90 ثانیه انجام شد. در ادامه با هدف بررسی خواص نقاط کوانتومی گرافن محصول، آزمون رامان و بررسی جذب ماوراء بنفش، نشر فتولومینسانس، طیف سنجی فروسرخ تبدیل فوریه و پراکنش نوری صورت گرفت. ریز ساختار توسط میکروسکوپ الکترونی گسیل میدانی مورد بررسی قرار گرفت. همچنین ریخت شناسی سطح و فاصله صفحات توسط میکروسکوپ روبشی با وضوح بالا بررسی شد. نتایج نشان داد که بهترین حالت از نظر اندازه و توزیع پراکندگی ذرات، تولید در دمای 220 درجه سانتی گراد و مدت زمان 60 ثانیه بوده به گونه ای که بیش از 45 درصد ذرات دارای اندازه 3 نانومتر می باشند. همچنین بیش ترین میزان شدت جذب در این نمونه و در طول موج 244 نانومتر ظاهر شد. افزایش زمان تولید نیز موجب درشت تر شدن نقاط کوانتومی گرافن و پراکندگی بیشتر در اندازه ذرات تولید شده گردید. بررسی های فتولومینسانس در محدوده طول موج های برانگیختگی 400-340 نانومتر نیز ظهور یک پیک قوی را در نمونه تولید شده در دمای 220 درجه سانتی گراد و زمان کلسینه شدن 60 ثانیه در طول موج تحریک 380 نانومتر نشان داد.

    کلید واژگان: نقاط کوانتومی گرافن، گلوتامیک اسید، تولید، جذب، فتولومینسانس
    M. Nazari, H. R. Baharvandi *, N. Ehsani

    Graphene quantum dots are a new member of the carbon family with various applications rapidly developing due to their unique properties. This research aims to obtain this valuable nanomaterial using a convenient, quick, and easy production method called carburizing. For this purpose, production from the primary source of glutamic acid was done at temperatures of 210, 220, and 230 ºC and times of 60 and 90 s. Next, the Raman test and fourier transform infrared spectroscopy, dynamic light scattering, photoluminescence, and ultraviolet-visible spectroscopy were performed to investigate the properties of graphene quantum dots of the product. The microstructure was examined by field emission escanning electron microscopy images. Also, the morphology of the surface and the distance between the planes were investigated by high resolution transmission electron microscopy. The results showed that the best sample in terms of distribution and particle size was production at 220°C for 60 s with 3 nm in particle size for over 45% of the particles. Moreover, the highest absorption intensity in this sample was appeard at the wavelength of 244 nm. An increase in the production time caused the graphene quantum dots to be coarser with greater dispersion in particle size distribution. Photoluminescence studies in the excitation wavelength range of 340-400 nm revealed the appearance of a strong peak in the sample produced at 220 ºC and calcination time 60 s at the excitation wavelength of 380 nm.

    Keywords: Graphene Quantum Dots, Glutamic Acid, Synthesis, Absorption, Photoluminescence
  • سپیده رستمی، محمدتقی بیگی نصیری، محمود نظری*، محسن چراغی زاده
    مطالعه حاضر به منظور بررسی امکان سنجی تعیین جنسیت جنین مرغ بومی ایران با استفاده از طیف سنجی رامان انجام شد. تعیین جنسیت جنین ها با استفاده از طیف سنجی رامان با طول موج  nm785 در روز 5/3 انکوباسیون انجام گرفت. صحت سنجی این روش با استفاده از روش واکنش زنجیره ای پلیمراز مورد بررسی قرار گرفت. طیف های به دست آمده از طیف سنج رامان با استفاده از نرم افزار Origin رسم شده و مورد تجزیه و تحلیل قرار گرفتند. شاخص های اصلی مورد استفاده جهت تجزیه و تحلیل طیف رامان، شدت اوج های رامانی و نسبت شدت اوج های غالب بودند. در واکنش زنجیره ای پلیمراز، یک قطعه به طول 461 جفت باز برای جنین های با جنسیت نر (ZZ) و دو قطعه با طول های 461 و 322 جفت باز برای جنین هایی با جنسیت ماده (ZW) تکثیر شد. نتایج طیف سنجی نشان داد شدت باندهای رامانی در جنسیت های مختلف متفاوت است، به طوری که شدت باندهای رامانی در جنس نر، بیشتر و در جنس ماده، کمتر بود. بنابراین، تغییرات شدت طیف های رامان را می توان ملاک تشخیص جنسیت قرار داد. همچنین، نتایج حاصل از رسم نمودار شمعی داده ها به صورت تجمعی نشان داد که مقادیر میانه و میانگین در هر دو نسبت برای جنسیت نر دارای مقدار بزرگتری در مقایسه با جنسیت ماده بود. با توجه به نتایج به دست آمده، این گونه استنباط می شود که طیف سنجی رامان می تواند به عنوان روشی مناسب جهت تعیین جنسیت جنین مرغ طی مراحل جوجه کشی مورد استفاده قرار گیرد و به دلیل کوتاه بودن زمان انجام آزمایش می تواند بهترین شرایط را برای استقرار در صنعت فراهم کرده و جنسیت را با دقت بالا مشخص نماید.
    کلید واژگان: تعیین جنسیت، جنین مرغ، طیف سنجی رامان، واکنش زنجیره ای پلیمراز
    S. Rostami, M. T. Beigi Nassiri, M. Nazari *, M. Cheraghizadeh
    Introduction
    The sex of chickens considerably impacts production performance and economic benefits in poultry farming. Male birds cannot lay eggs and usually have a lower ratio of meat to feed than broilers. Male chicks are typically killed immediately after hatching since they are redundant in the industry and male chicks will neither be suitable for egg production nor meat production. Day-old male chicks in the laying hen industry are usually culled immediately after hatching. As a result, this issue has caused moral concerns in societies. Efforts are underway to develop technology for automatically determining the sex of chick embryos, aimed at establishing a stable and efficient poultry farming system. In large commercial hatcheries, the sexing of newly born chicks is generally accomplished by three different methods according to new hatching lines' vent, color, or feathers. However, these methods are still time- and labor-consuming. If sex can be identified at an early embryonic stage or even before incubation, male eggs could be used as feed components. Moreover, fewer eggs would need to be incubated, which would reduce feed space requirements, CO2 emissions, and energy consumption, which are all economically beneficial to farmers and the environment. In recent decades, researchers have used various in ovo sexing strategies in chicken eggs before hatching or incubation. Some invasive and noninvasive studies that have been conducted for in ovo sexing of chicken eggs can be divided into five major categories: (i) molecular-based techniques, (ii) spectral-based techniques (Raman spectroscopy, fluorescent, 3D X-ray), (iii) acoustic-based techniques, (iv) morphology-based techniques, and (v) volatile organic compound (VOC)-based techniques. Commercially applicable methods must be noninvasive, rapid enough for real-time applications, economically feasible, and ethically acceptable. An alternative method, to prevent the removal of day-old chicks, is a non-invasive method to determine the sex of the egg in the early stages of hatching before the development of the nervous system. Recently, Raman spectroscopy was reported to determine the sex of eggs at the incubation stage. Raman spectroscopy is based on the Raman effect, whereby when incident light (wavelength 750–850 nm) excites molecules in a tissue, the molecules reflect light at a different wavelength. The reflected light's wavelength is characteristic of various chemical components and allows the detection of the atheromatous plaque chemical synthesis. Raman spectroscopy is a powerful tool expected to revolutionize chick sex determination because it can provide information about biological molecules. Thus, Raman spectroscopy is suitable for analyzing living organisms, leading to its widespread adoption across various biological and medical applications. Therefore, resonance Raman spectroscopies have found application in blood analysis, with some studies exploring its utility in chick sexing. For this purpose, the present study was carried out to investigate the feasibility of determining the sex of Iranian native chicken embryos using the Raman spectroscopy.
    Materials and methods
    To carry out this research, 100 fertilized eggs of Iranian native chickens were used. The sex of the embryos was determined using Raman spectroscopy with a wavelength of 785 nm during the fourth day of incubation. Validation of this method was investigated using the polymerase chain reaction (PCR) technique. Sequence alignment of CHD-Z and CHD-W allele sequences amplified by PCR technique. The amplified DNA fragments were single and double DNA bands in the size of 461 bp for the CHD-Z and 322 bp for the CHD-W genes. The PCR was carried out using a PCR master kit with specific primers (the forward primer: 5′- TATCGTCAGTTTCCTTTTCAGGT -3′, the reverse primer: 5′- CCTTTTATTGATCCATCAAGCCT -3′). Thermal cycling conditions for DNA amplification were: 1 cycle of initial denaturation at 94°C for 5 minutes; 35 cycles comprising 30s at 94°C for the denaturation, 30s at 59°C for annealing, 30s at 72°C for the elongation; and a final extension cycle at 72°C for 5 minutes. The PCR products were analyzed by electrophoresis on 2.5% agarose gel against a DNA Ladder 100bp, and visualized using the safe staining on UV transilluminator. The data obtained from the Raman spectrometer was analyzed using the Origin software. The main indices used to study the data were the intensity of the Raman peaks and the ratio of the dominant peak intensity. Additionally, principal component analysis (PCA) was employed to identify any patterns in the data. To calculate PCA1 and PC2, the ratios of I769/I838 and I1141/I1251 peaks were considered, respectively. PCA analysis can choose features that have a greater impact on the final result, depending on the data and the scope of their changes.
    Results and discussion
    The result of PCR showed that one fragment with a length of 461 bp was amplified for male embryos (ZZ) and two fragments with lengths of 461 and 322 bp were amplified for female embryos (ZW(. The study found that there are differences in the intensity of Raman bands between genders. Males have higher intensity while females have lower intensity. Therefore, changes in Raman spectra intensity can be used to identify gender. Additionally, the candlestick chart of the data showed that median and average values for males were larger than for females. Furthermore, the results obtained from PCA analysis showed that the variance percentages for PC1 and PC2 were 53.69% and 46.31%, respectively. PC2 is more reliable as it has less deviation.
    Conclusions
    Based on the results obtained from the study, it can be concluded that Raman spectroscopy is a reliable method for determining the gender of chicken embryos during incubation. This test is quick, accurate, and can be easily incorporated into the industry to determine the gender of embryos without resorting to the practice of killing day-old chicks. Not only is this method more ethical, but it also offers a high level of accuracy, making it an attractive alternative for the industry. In general, these results demonstrate the potential application of hematological traits in developing an automatic in ovo embryo sexing method through spectroscopic analysis.
    Keywords: Sex Determination, Chicken Embryo, Raman Spectroscopy, Polymerase Chain Reaction
  • H Hashemi, Reza Ezzati, Nasser Mikaeilvand Mikaeilvand, M Nazari
    This paper presents a novel approach for modeling and analyzing complex systems withuncertain data by using fuzzy calculus and time-fractional di erential equations. Speci cally,we propose the use of the fuzzy Atangana-Baleanu time-fractional derivative with non-singularkernels for fuzzy functions as a suitable fractional derivative type for the qualitative analysis offractional di erential equations in fuzzy space. Additionally, we provide a method for numer-ically solving fuzzy linear time-fractional equations in uid dynamics using the fuzzy Laplacetransform iterative method. The e ectiveness and practical relevance of our proposed methodare demonstrated through concrete examples, including the fuzzy time-fractional Advection-Dispersion equation, the fuzzy time-fractional Navier-Stokes equation, and Couette ow .These examples showcase the potential of our method to address real-world problems in uiddynamics and provide a clear illustration of the solution steps involved. Our ndings high-light the importance of considering fuzzy calculus and time-fractional di erential equations inmodeling and analyzing complex systems with uncertain data.
    Keywords: The Fuzzy Atangana-Baleanu Time-Fractional Derivative, The Fuzzy Time-Fractional Advection-Dispersion Equation, The Fuzzy Time-Fractional Navier-Stokes Equation, Couette Flow
  • هایده جوادزاده شهشهانی*، محدثه نظری
    سابقه و هدف

    مدیریت خون بیمار، تزریق خون غیرضروری را کاهش می دهد. آشنایی پزشکان با این برنامه به بهبود پیامد بیماران می انجامد. هدف پژوهش ارزیابی تاثیر آموزش بر آگاهی دستیاران پزشکی درباره مدیریت خون بیمار در مراکز درمانی یزد سال 1402-1401 بود.

    مواد و روش ها

    در این مطالعه مداخله ای قبل و بعد، 57 نفر از دستیاران پزشکی پرسشنامه 20 سوالی برای سنجش آگاهی در مدیریت خون بیمار را پر کردند. روایی پرسشنامه با نظرسنجی از پزشکان مجرب در مدیریت خون بیمار سنجیده شد. پایایی با سنجش آلفای کرونباخ 8/0 بود. آگاهی پزشکان قبل و بعد از آموزش با استفاده از پرسشنامه ارزیابی شد. داده ها با استفاده از آزمون هایt  و Paired-t در نرم افزار 20 SPSS بررسی شد.

    یافته ها

    شرکت کنندگان 35 (4/61%) زن و 22 (6/38%) مرد بودند. متوسط سن آن ها 45/5 ± 58/30 سال بود.  نمره آگاهی قبل از آموزش 77/3 ± 38/9 و بعد از آموزش 50/3 ± 01/14 به دست آمد (001/0 <p). کمترین پاسخگویی قبل از آموزش در حیطه های ارزیابی و مدیریت کم خونی بیمار پیش از مداخلات طبی و جراحی و دانش کاربرد خون اتولوگ بود. نمره آگاهی قبل و بعد از آموزش با سن، جنس، سابقه تجویز خون، رشته تخصصی و مدت طبابت ارتباط نداشت.

    نتیجه گیری

    آموزش به طور موثری منجر به افزایش دانش دستیاران شد. پیشنهاد می شود برنامه های آموزشی هدفمند با تاکید بر مدیریت کم خونی قبل از مداخلات و استفاده از خون اتولوگ، انتشار محتوای آموزشی به صورت راهنماها و گنجاندن طب انتقال خون و مدیریت خون بیمار در کوریکولوم آموزش پزشکی در نظر گرفته شود.

    کلید واژگان: طب انتقال خون، آموزش، آگاهی
    H. Javadzadeh Shahshahani*, M. Nazari
    Background and Objectives

    Patient blood management reduces unnecessary transfusions to improve patients' health. Familiarity of physicians with this program is necessary to improve the outcomes of patients health. This study was conducted to evaluate the effect of education on the level of knowledge of residents in medical centers in Yazd, 2022-2023.

    Materials and Methods

    The study was a before and after quasi-experimental intervention. 57 medical residents participated. A 20 question questionnaire measured the residents' knowledge level in patient blood management before and after the education. The validity of the questionnaire was measured by a survey of experienced physicians in the management of patient's blood. Reliability with Cronbach's alpha test was 0.8. The data were analyzed using t and Paired-t tests in SPSS 20 software.

    Results

    35 participants (61.4%) were women and 22 (38.6%) were men. Their mean age was 30.58 ± 5.45 years.The average knowledge scores were 9.38 ± 3.77 and 14.01 ± 3.50 before and after education, respectively (p < 0.001). The lowest response rate before instructions pertained to evaluation of patients' anemia before surgery and knowledge of autologous blood usage. The knowledge score had no significant relationship with age, sex, blood prescription history, and medical practice duration.

    Conclusions  :

    Education effectively increased the knowledge of residents. It is suggested to include hold targeted educational programs with emphasis on the areas of anemia management and the use of autologous blood, publish educational guides, and include transfusion medicine and the patient's blood management program in medical education curricula.

    Keywords: Transfusion Medicine, Education, Knowledge
  • R. Omidi, M. Simiari, S. Ovaysi *, M. Nazari, M. Rezaei

    In this work, nanoparticles of the metal fuel Zirconium (Zr) and nanoscale oxidizer BaCrO4 are synthesized considering their unique nanoparticle characteristics like mixing homogeneity and high surface/volume ratio. Using the synthesized fuel and oxidizer, the pyrotechnic mixture of Zr/BaCrO4 was developed under 4 different conditions and analyzed in terms of the thermal behavior and burning rate. In the synthesis stage, the oxidizer nanopowder BaCrO4 was developed through precipitating Barium Nitrate and Chromate Potassium in the vicinity of Dodecyl benzene sulfonate sodium (DBSS) stabilizer. Also, Zr nanopowder was prepared using direct reduction of Zr (NO3)2 by N2H2 and was coated by a 4% Collodion. Then, the pyrotechnic mixture Zr/BaCrO4 was charged and pressed in the constructed combustion chamber. The burning rate of the mixture was captured by the direct footage of the combustion process using digital cameras with 60 frame-per-second capabilities. The fastest burning occurs when both the fuel and the oxidizer are nano-scaled. The thermal behavior of the mixture was studied using the simultaneous thermal analysis (STA) machine within the temperature range of 25 to 1000 °C. Results of the thermal analysis show that the thermal decomposition temperature of the Zr/BaCrO4 mixture in the micron size is higher than in the nano size and the amount of destruction is lower. Increasing the concentration of zirconium in the nano-size from 10 to 50% leads to a decrease in the decomposition temperature from 565 to 437 °C, while the pyrotechnic mixture destruction rate increases from 39% to over 63%.

    Keywords: pyrotechnic, burning rate, Solid fuel, oxidizer, Zr, BaCrO4 mixture, Thermal analysis
  • اویس حسن پور، فرشاد قاسمی*، فریدون عباسی دوانی، محمد نظری

    شتاب دهنده های الکترواستاتیک، شتاب دهنده هایی هستند که از یک اختلاف پتانسیل ثابت با زمان برای ایجاد میدان الکتریکی مناسب و درنتیجه شتاب دهی یون و الکترون استفاده می کنند. شتاب دهنده ی داینامیترون که از شتاب دهنده های الکترواستاتیک پرکاربرد در صنعت است، از یک مدار چندبرابرکننده ی ولتاژ برای تولید ولتاژ موردنیاز برای شتاب دهی استفاده می کنند. المان های خازنی مدار چندبرابرکننده ی ولتاژ در شتاب دهنده ی داینامیترون توسط الکترود نیمه استوانه ای که در یک آرایه ی ستونی قرار دارند تشکیل می شود. طراحی این ستون از الکترودها که به ستون افزاینده ی ولتاژ نیز موسوم است فرایندی پیچیده است که نیازمند مطالعه و شبیه سازی در دو حوزه ی الکترومغناطیس و مدل مداری به صورت هم زمان است. طراحی مفهومی این ساختار نیز به دلیل به هم پیوستگی برخی پارامترها امری پیچیده می باشد. در این مقاله پس از معرفی مختصر بخش های مختلف یک شتاب دهنده ی داینامیترون و پرداختن دقیق به بخش ستون افزاینده ی ولتاژ، به ارایه ی یک روند برای طراحی مفهومی ستون افزاینده ی ولتاژ یک شتاب دهنده ی داینامیترون می پردازیم.

    کلید واژگان: شتاب دهنده، الکترواستاتیک، ولتاژ بالا، چندبرابرکننده
    O. Hasanpour, F. Ghasemi *, F. Abbasi Davani, M. Nazari

    Electrostatic accelerators use a constant potential difference to create a suitable electric field and accelerate ions and electrons. One of the most widely used electronic accelerators in the industry, the dynamitron accelerator uses a voltage multiplier circuit to generate the voltage required for acceleration. The capacitor elements of the voltage multiplier circuit in the dynamitron accelerator are constituted of semi-cylindrical electrodes located in a columnar array. The design of this column of electrodes, also known as the voltage multiplier column, is a complex process. It requires the study and simulation of electromagnetic fields and circuit models. The conceptual design of this structure is also complicated due to parameter interdependence. In this article, after a brief introduction to different parts of the dynamitron accelerator and details of voltage multiplier columns, a process for the conceptual design of the voltage columns of a dynamitron accelerator is presented.

    Keywords: Accelerator, Electrostatic, High-voltage, Multiplier
  • مریم نظری، حمیدرضا بهاروندی*، ناصر احسانی
    هدف از این تحقیق، ساخت و بررسی خواص نانوکامپوزیت های SiC-5TiB2 تقویت شده با نانوذرات گرافن کوانتوم دات به روش ساخت تف جوشی بدون فشار می باشد. بدین ترتیب مواد اولیه SiC، TiB2 و گرافن کوانتوم دات در ابعاد نانومتری مورد استفاده قرار گرفتند. ابتدا پیش از انجام هرگونه اقدامی، با استفاده از نرم افزار Minitab 14 طراحی نمونه های آزمایشی صورت گرفت. طراحی با روش تاگوچی مطابق با آرایه L9 انجام شد و پارامترهای میزان تقویت شونده گرافن کوانتوم دات در سه سطح 0/2 و 0/6 و 1 درصد وزنی و دمای تف جوشی در مقادیر 2000، 2100 و 2200 درجه سانتی گراد تعریف شدند. فرآیند تف جوشی در دماهای مشخص در اتمسفر آرگون به مدت زمان دو ساعت انجام شد. در ادامه، آنالیزهای پراش اشعه ایکس، طیف سنجی رامان، میکروسکوپ الکترونی روبشی نشر میدانی و طیف سنجی تبدیل فوریه مادون قرمز صورت گرفت. همچنین از آزمون های تعیین چگالی، میکروسختی و چقرمگی شکست به منظور بررسی خواص فیزیکی و مکانیکی استفاده شد. ریز ساختار نمونه ها نیز با هدف بررسی مکانیزم های چقرمگی شکست مورد بررسی واقع شدند. نتایج نشان داد که پارامتر میزان تقویت شونده در رده اول تاثیر گذاری و دمای تف جوشی در رده دوم قرار دارد و بهترین نتایج در نمونه با مقدار 0/6 درصد وزنی گرافن کوانتوم دات و دمای تف جوشی 2100 درجه سانتی گراد حاصل شده است که میزان سختی و چقرمگی شکست دراین نمونه به ترتیب 27/7 گیگاپاسکال و MPa.m1/2 3/3 به دست آمد.
    کلید واژگان: کاربید سیلیسیم، گرافن کوانتوم دات، نانو کامپوزیت SiC-5TiB2، تف جوشی، تاگوچی
    M. Nazari, H. R. Baharvandi *, N. Ehsani
    The purpose of this research was to fabricate and investigate the properties of SiC-5TiB2 nano composites reinforced by gaphene quantum dot nanoparticles via pressure less sintering method. In this way, SiC, TiB2, and graphene quantum dot raw materials were used in nanometer dimensions. First, before performing any laboratory operations, experimental samples were designed using Minitab 14 software. The design was done by the Taguchi method according to the L9 array and the parameters of the amount of gaphene quantum dot amplification in three levels were set at 0.2, 0.6, and 1 wt.% and sintering temperatures were defined as 2000, 2100, and 2200°C. The sintering process was carried out at certain temperatures in argon atmosphere for 2 h. XRD, FESEM, FTIR and Raman spectroscopy were performed. Density, micro hardness, and fracture toughness measurements were used for further investigations of physical and mechanical properties. The microstructure of the samples was also observed to determine the fracture toughness mechanisms. The results showed that the parameter of the amount of reinforcement was in the first rank of influence and the sintering temperature was in the second rank, and the best results were obtained in the sample with the amount of 0.6 wt.% of gaphene quantum dot and the sintering temperature of 2100 °C, where hardness and fracture toughness values were obtained to be 27.7 GPa and 3.3 MPa.m1/2, respectively.
    Keywords: SiC, graphene quantum dot, SiC-5TiB2 nanocomposite, sintering, Taguchi
  • M. Nazari, G. Attaran Fariman*, Y.B. Okolodkov

    Harmful algal blooms caused by dinoflagellates have significant adverse effects on environmental and public health. This study aimed to investigate the effect of water physicochemical parameters on the annual cycle of epiphytic dinoflagellates in the northern Chabahar Bay coastal waters of the Oman Sea (Iran). The macroalgal samples with associated epiphytes were collected seasonally from 6 coastal sites in spring, summer, atumn 2019 and winter 2020. The water physicochemical parameters were measured, and the data were analyzed using a one-way ANOVA and the principal component analysis (PCA). Twelve potentially toxic dinoflagellate species from five genera were identified during the four sampling seasons. Amphidinium carterae with an average of 11.22% and A. operculatum with an average of 10.77% of the total abundance of epiphytic dinoflagellates were the dominant species, and Gambierdiscus australes showed an average of 6.48%.Based on the PCA, the abundance of certain species was found to be influenced by different environmental factors. The PCA revealed that NO2, NO3 and SiO4 values had the greatest impact at sites with high abundances of A. operculatum, Prorocentrum concavum, P. emarginatum, P. rhathymum and G. balechii. Furthermore, PO4 concentration had the greatest impact at the sites with high abundances of A. carterae, P. lima, Ostreopsis lenticularis, O. heptagona, G. balechii, G. toxicus, G. australes and Coolia monotis. The results obtained highlighted a significant impact of dissolved oxygen, pH, salinity, temperature and nutrients on the epiphytic dinoflagellate species abundances in the study area.

    Keywords: Epiphytic Dinoflagellates, Microphytobenthos, Annual Cycle, HABs, Harmful Algal Blooms, Red tide
  • M. Didehvar, T. Rakhshani, E. Janfaza, A. Soltani, M. Nazari, L. Ghahremani*
    Aims

    Leishmaniasis is a skin disease spread by mosquitos from infected animals or humans to healthy humans. It can have a negative effect on a patient’s quality of life. The purpose of this study was to assess the impact of PRECEDE model-based training of healthcare personnel on the preventive behavior of the disease in covered households in Larestan, Iran.
    Materials &

    Methods

    This controlled semi-experimental study was done on the households served by comprehensive rural health centers in Larestan, Iran. First, two comprehensive health centers were randomly assigned to the intervention or control groups. Eighty covered households were divided into two groups. The intervention group's health workers received training in four face-to-face sessions. Health workers then trained the families who were covered by them. Both groups completed a researcher-made questionnaire before and two months after the intervention. The independent t-test, paired t-test, ANCOVA, and Cohen's D were used to analyze the data by SPSS 20 software at a significance level of less than 0.05.

    Findings

    The mean scores of predisposing factors, enabling factors, reinforcing factors, and behavior in the intervention group differed significantly from the control group after training, and the effect size of each construct indicated the effectiveness of training.

    Conclusion

    Training of health workers based on the PRECEDE model plays a significant role in adopting Leishmaniasis prevention behavior in people under their care.

    Keywords: Leishmaniasis, Cutaneous, Health Personnel, Prevention, Control, Health Education
  • سعید باقری کیا*، فرامرز سیدی، حبیب الله سوقی، منوچهر خدارحمی، فریبا نقی پور، مهدی نظری

    به منظور ارزیابی عملکرد کمی و کیفی ارقام گندم نان بهاره تحت تاریخ کاشت های مختلف، آزمایشی در طی دو سال زراعی (1401-1399) در ایستگاه تحقیقات کشاورزی گنبد، استان گلستان، به صورت کرت های خرد شده بر پایه طرح بلوک های کامل تصادفی با چهار تکرار اجرا شد. هفت تاریخ کاشت (10 آبان، 20 آبان، 30 آبان، 10 آذر، 20 آذر، 30 آذر و 10 دی ماه) در کرت های اصلی و چهار ژنوتیپ گندم نان (آراز، آرمان، تکتاز و لاین N-93-9) در کرت های فرعی قرار گرفتند. نتایج نشان داد که تاخیر در کاشت منجر به کاهش معنی دار طول مراحل فنولوژیکی و دوره پر شدن دانه شد. بیشترین عملکرد دانه در تاریخ کاشت 20 آبان (5813 کیلوگرم در هکتار) به دست آمد که با عملکرد دانه در تاریخ کاشت های 30 آبان (5788 کیلوگرم در هکتار) و 10 آذر (5641 کیلوگرم در هکتار) تفاوت معنی داری نداشت. در اکثر صفات زراعی، تاریخ کاشت های انتهایی (30 آذر و 10 دی) به طور معنی داری مقادیر کمتری نسبت به تاریخ کاشت های 20 آبان، 30 آبان و 10 آذر داشتند. مقایسه میانگین اثر متقابل تاریخ کاشت×رقم نشان داد که رقم آرمان در تاریخ-های کاشت 20 و 30 آبان، رقم آراز در تاریخ کاشت های 20 آبان، 30 آبان و 10 آذر و رقم تکتاز در تاریخ کاشت 30 آبان بیشترین عملکرد دانه را داشتند. در سه تاریخ کاشت پایانی (20 آذر، 30 آذر و 10 دی)، عملکرد دانه ارقام تکتاز و آراز بیشتر از سایر لاین ها بود. نتایج بررسی صفات مرتبط با کیفیت نانوایی نشان داد که دو تاریخ کاشت انتهایی (30 آذر و 10 دی) از نظر محتوای پروتئین و گلوتن مرطوب مقادیر بالاتری نسبت به دو تاریخ کاشت ابتدایی (10 آبان و 20 آبان) داشتند. رقم تکتاز با داشتن بیشترین محتوای پروتئین و گلوتن مرطوب، بالاترین کیفیت نانوایی را داشت.

    کلید واژگان: دوره پر شدن دانه، عملکرد دانه، کیفیت نانوایی، مراحل فنولوژیک
    S. Bagherikia*, F. Sayyedi, H. Soughi, Manoochehr Khodarahmi, F. Naghipour, M. Nazari

    In order to evaluate the quantitative and qualitative performance of spring bread wheat cultivars under different planting dates, an experiment was conducted in Gonbad Agricultural Research Station, Gonbad, Golestan province, Iran, during two cropping seasons (2020-2022) as split plot based on randomized complete block design (RCBD) with four replications. Seven planting dates (1 November, 11 November, 21 November, 1 December, 11 December, 21 December and 31 December) were placed in main plots and four bread wheat genotypes (Araz, Arman, Taktaz and N-93-9) were placed in subplots. The delayed planting led to a significant decrease in the length of the phenological stages and the grain filling period. The highest grain yield was obtained from the planting at 11 November (5813 kg ha-1), which was not significantly different from grain yield in 21 November (5788 kg ha-1) and 31 November (5641 kg ha-1) planting dates. In most of the agronomic traits, the delayed planting dates (21 December and 31 December) had significantly lower values than planting in 11 November, 21 November and 1 December. Mean comparison for interaction effect of planting date×cultivar showed that planting Arman cultivar in 11 November, Araz cultivar in 11 November, 21 November and 1 December, Arman cultivar in the 21 November and Taktaz cultivar in the 21 November led to the highest grain yield. In the three delayed planting dates (11 December, 21 December and 31 December), the grain yield of Taktaz and Araz cultivars was higher than other genotypes. Mean comparisons on the traits related to bread-making quality showed that the two delayed planting dates (21 December and 31 December) had higher values in terms of protein and wet gluten content, compared to the two early planting dates (1 November and 11 November). Taktaz cultivar had the highest bread-making quality, particularly because it indicated the highest protein and wet gluten content.

    Keywords: Grain filling period, Grain yield, Bread-making quality, Phenological stages
  • هدی فتح زاده، فاطمه حیدری، ماه نظری
    زمینه و هدف

    در تاریخ ادب فارسی، رشته ای از نوشتارها با نام عمومی مجالس شناخته میشوند. این نوشته ها حاصل نشستها و حلقه های وعظ صوفیان و متشرعان بوده است. وعظ و تذکیر صوفیان و متشرعان اهل منبر اصطلاحا «مجلس گویی» و آثار مکتوبی که از این راه خواه به دست خود واعظان و خواه به دست برخی مریدان پدید آمده است «مجالس» و چنین سنت نوشتاری «مجلس نویسی» نامیده میشود. این تحقیق علاوه بر معرفی این آثار و گویندگان آن، به مقایسه زبان گفتاری مجالس سبعه مولانا (سده هفتم هجری) و مجالس عتیقی تبریزی (سده های هفتم و هشتم هجری) میپردازد.

    روش مطالعه

    این مقاله براساس مطالعات کتابخانه ای و به شیوه تحلیلی توصیفی انجام شده است.

    یافته ها

    درواقع مجالس سبعه مولانا تا حدی طنین پیش آهنگ مثنوی است. زمان تالیف مجالس سبعه دقیقا معلوم نیست، اما ظاهرا از طرف سلطان ولد یا حسام الدین چلبی در اثنای وعظ تحریر یافته، بعدها با رعایت صورت اصلی بازخوانی شده، مطالبی به آن افزوده شده و شاید از نظر شخص مولانا نیز گذشته و احتمالا خود او نیز تصحیحات و اضافاتی بر آن داشته است. مجالس به خط تعلیق خوب و قلم ریز و فاصل میان مجالس به خط نسخ درشت کتابت شده است. نسخه عکسی مجالس تقریبا 16 صفحه است و غیر از صفحه اول که 32 سطر و صفحه آخر که 20 سطر دارد، همه صفحات دارای 41 سطر است. سخنان و لطایف و اشارات عتیقی در 67 قسمت نوشته شده است؛ اما ظاهرا تعداد مجالس باید کمتر از این باشد؛ چه تاریخ برخی مجالس در یک روز است. مجالسی که تاریخ ایراد آنها یکسان است، جدا از هم نیست؛ بنابراین تعداد مجالس، نه 67 بلکه22 عدد است.

    نتیجه گیری

    هر هفت مجلس مجالس سبعه با خطبه ای عربی آغاز شده است و تقریبا همه عبارات ابتدای هر مجلس مسجع است. مجالس سبعه سرشار است از تشبیهات و تمثیلاتی که با زبان شیرین مولانا بیان شده است. مجالس عتیقی مملوست از ایماژها و صورخیال شگفت آور. عتیقی به سبک ادبا سخن میگوید و ازجمله هنرمندانی است که با توجه به نبوغ خود تصاویر بکر و دست اولی بیان کرده است.

    کلید واژگان: زبان، مولانا، عتیقی تبریزی، مجالس، مجالس سبعه
    H. Fathzadeh F. Heydari*, M. Nazari
    BACKGROUND AND OBJECTIVES

    In the history of Persian literature, a series of writings are known by the general name of Majalis. These writings are the result of meetings and preaching circles of Sufis and jurists. The sermons and admonitions of the Sufis and the religious scholars from the pulpit are called "Majales-gooyi" and the written works that were created in this way either by the hands of the preachers themselves or by the hands of some disciples are called "Majales" and such a writing tradition is called "Majales-writing". To be in addition to introducing these works and their speakers, this research compares the spoken language of these two parliaments.

    METHODOLOGY

    This article is based on library studies and is done in an analyticaldescriptive way.

    FINDINGS

    In fact, Rumi's Majlis Sabe' is to some extent the echo of Masnavi's prelude. The exact time of writing Majlis Saba' is not known, but apparently it was written by Sultan Valad or Hessam al-Din Chalapi during a sermon, later it was reread according to the original form, some material was added to it, and perhaps it was passed down from Rumi's personal opinion, and probably himself too. It has had corrections and additions. The congregations are written in a fine suspension line and a fine pen, and the space between the congregations is written in a thick script. The photo version of Majalis is approximately 16 pages long, and except for the first page which has 32 lines and the last page which has 20 lines, all pages have 41 lines. Ancient sayings and allusions are written in 67 parts. But apparently, the number of councils should be less than this; What is the date of some assemblies in one day? Because the meetings that have the same objection date are not separate from each other. Therefore, the number of assemblies is not 67 but 22.

    CONCLUSION

    All seven Majalis Sab'e have started with Arabic sermons and almost all phrases at the beginning of each Majalis are Masjid. Majlis Sab'e is full of similes and allegories expressed in the sweet language of Rumi. Ancient assemblies are full of amazing images and pictures. Atigi speaks in a literary style and is one of the artists who, due to his genius, has expressed pristine and first-hand images.

    Keywords: Language, Rumi, Atighi Tabrizi, Majlis, The Majlis Sabe'
  • کمیل نوزاد، سید مجتبی واردی کولایی*، مصطفی نظری

    مدل سازی ریاضی سیستم های بیولوژیکی یکی از مطلوب ترین روش ها برای مطالعه این پدیده های زیستی می باشد. توسعه ی مدل های ریاضی برای شبیه سازی، کنترل و پیش بینی پدیده ها همواره اهمیت داشته است. از جمله مزایای استفاده از مدل های ریاضی، کاربرد آن ها در بهینه سازی می باشد. مساله درمان سرطان به عنوان یک مساله کنترل بهینه با هدف کاهش غلظت سلول های سرطانی در بازه زمانی درمان می باشد. در حل این مساله موضوع مهمی که در مطالعات قبلی در نظر گرفته نمی شد، غلظت داروی مصرفی بود، که به طور قابل توجهی بر سلامت بالینی بیماران تاثیر می گذاشت. با توجه به این موضوع، مطالعه حاضر با هدف به دست آوردن یک پروتکل بهینه تجویز دارو با حداقل رساندن غلظت سلول های سرطانی و حداقل رساندن غلظت دارو انجام گرفت. حل این مساله چندهدفه برای اولین بار با الگوریتم بهینه سازیNSWOA  انجام شده و نتایج با الگوریتم NSGA-II مقایسه شدند. منحنی جبهه پارتو به دست آمده از هر دو الگوریتم، مجموعه ای از بهینه ترین راه حل ها را ارایه می دهد که با توجه به معیارهای انتخابی درمان، یکی از این نقاط به عنوان پروتکل تجویز دارو انتخاب می شود. مقایسه ی نتایج نشان می دهد الگوریتم NSWOA توانمندی بسیار خوبی در حل این مساله بهینه سازی دارد.

    کلید واژگان: مدل ریاضی، سرطان، بهینه سازی چندهدفه، شیمی درمانی، الگوریتم NSGA-II، الگوریتم NSWOA
    K. Nozad, S. M. Varedi-Koulaei*, M. Nazari

    Mathematical modeling of biological systems is one of the most desirable methods for studying the behavior of these biological phenomena. The development of mathematical models has always been important for simulating, controlling, and predicting phenomena. One of the advantages of mathematical models is their application in optimization. Solving cancer therapy as an optimal control problem aims to reduce the concentration of cancer cells in the treatment period. In this solution, an important aspect that was not considered in previous studies was the optimum drug concentration that significantly affected patients' clinical health. Due to this, the present study was carried out to obtain an optimal drug-prescribing protocol to minimize the concentration of cancer cells and the drug concentration. This Multi-objective problem has been solved, for the first time, using the NSWOA algorithm, and the results were compared with the NSGA-II algorithm. Pareto front curve obtained from both algorithms offers a set of the most optimal solutions. According to the criteria of treatment choice, one of these points is chosen as the drug administration protocol.

    Keywords: Mathematical model, Cancer, Multi-objective Optimization, Chemotherapy, NSGA II, NSWOA
  • M. Nazari*, M.H. Shafiei, L. Ghahremani
    Aims

    Colorectal cancer is a global health problem, but most of these patients are curable through early diagnosis. The present study aimed to investigate the effect of an educational intervention through a campaign on health anxiety and participation of middle-aged people (ages 50-70 years) in CRC screening based on the Health Belief Model in urban areas.

    Materials & Methods

    A quasi-experimental study was conducted on 390 people in age range 50-70 years in Parsian in 2021. The participants were selected using convenience sampling. Champion’s Health Belief Model Scale and Health Anxiety Questionnaire were used to collect data. The educational intervention was carried out in the form of a campaign through educational video clips and a banner for four weeks. Data analysis was done in SPSS 26 software using descriptive statistics and univariate analysis of covariance.

    Findings

    There was a significant difference between the intervention and control groups in terms of the mean scores of the Health Belief Model scale (knowledge, perceived severity, perceived sensitivity, perceived benefits, perceived barriers, perceived self-efficacy, and action guide) and the health anxiety questionnaire (consequences of disease and probability of disease) after the intervention (p<0.001).

    Conclusion

    The constructs of the Health Belief Model are good determinants of the action of high-risk individuals to undergo fecal occult blood testing. This highlights the necessity of implementing comprehensive educational programs focusing on the constructs of the Health Belief Model in this population.

    Keywords: Health campaign, Colorectal cancer, Health belief, Health anxiety
  • داریوش آجرلو، مصطفی نظری*، محسن نظری، ناصرالدین سپهری
    مدل ریاضی در طراحی و بهینه سازی سیستم های انتقال حرارت نقش بسزایی دارد. به دلیل وجود مود انتقال حرارت تشعشع در محیط خلاء، رفتار چنین سیستم هایی بسیار غیرخطی است. در این مقاله، یک مدل معادلات دیفرانسیل معمولی غیرخطی جدید برای یک محفظه حرارتی مکعبی خلاء جهت استفاده در محاسبات بلادرنگ، استخراج شده است و اعتبار مدل با استفاده از یک مجموعه تجربی مورد بررسی قرار گرفته است. برای این منظور، یک ورودی مشخص به مدل ریاضی و مجموعه تجربی داده شده که با بخشی از این اطلاعات، پارامترهای سیستم با استفاده از الگوریتم بهینه سازی ژنتیک استخراج شده است. سپس، رفتار مدل ریاضی و سیستم تجربی با پارامترهای استخراج شده، در سیکل هایی که در بهینه سازی از آن ها استفاده نشده است، مقایسه شده است. مقایسه های انجام شده، صحت مدل ریاضی ارایه شده را نشان می دهد. سپس، برای بررسی دقیق تر مدل و مشاهده میزان تاثیر پارامترهای مدل بر رفتار سیستم، از روش مونت کارلو برای آنالیز حساسیت کلی مدل استفاده شده است. برای این منظور از نمونه برداری لاتین هایپرکیوب و ضرایب همبستگی رتبه جزیی برای رتبه بندی پارامترها استفاده شده است. نتایج نشان می دهد که ضریب رسانش حرارتی عایق ها مهم ترین پارامتر تاثیرگذار بر رفتار سیستم است.
    کلید واژگان: مدل سازی حرارتی، انتقال حرارت تشعشعی، کوره خلاء، شبیه سازی مونت کارلو، الگوریتم ژنتیک
    D. Ajorloo, M. Nazari *, N. Sepehry
    Mathematical modeling plays an important role in designing and optimizing of heat transfer systems. Due to radiation heat transfer mode in a vacuum environment, the behavior of the system is very nonlinear. In this paper, a new nonlinear ODE model for a vacuum box heat chamber is developed which is suitable for online computation, and the validity of the model is investigated using an experimental set. A specific input is given to the both mathematical model and the experimental set. With some of this data, system parameters are extracted using the genetic algorithm. Then, the behavior of the mathematical model and the experimental system with the extracted parameters are compared using cycles that have not been used in optimization. The comparison shows the accuracy of the proposed mathematical model. Then, to examine the model more closely and to observe the effect of model parameters on system behavior, the Monte Carlo method was used to analyze the overall sensitivity of the model. For this purpose, Latin hypercube sampling and partial rank correlation coefficients have been used to rank the parameters. The results show that the thermal conductivity of insulators is the most important parameter affecting the behavior of the system.
    Keywords: Thermal modeling, Radiation heat transfer, Vacuum furnace, Monte Carlo Simulation, Genetic Algorithm
  • مهدی نظری، حسین دقیق کیا

    هدف در زمینه ی انجماد و نگه داری طولانی مدت اسپرم در گونه های مختلف پیشرفت های شایان توجهی صورت گرفته است. اما این فرایند آسیب های قابل توجهی به سلول اسپرم وارد می کند.در مقاله حاضر سعی شده است مروری بر مطالعات مربوط به مخازن نگه داری اسپرم ها در طیور و نقش آن ها در عمل کرد اسپرم داشته باشد.مطالعات انجام شده بر چگونگی دخیره ی طولانی مدت اسپرم در برخی از گونه ها بدون نیاز به مواد افزودنی خاصی توجه محققین را به خود جلب کرده است. محققین به این نتیجه رسیدند که با درک درست از چگونگی ذخیره ی اسپرم ها در اویداکت می توان اسپرم ها را برای مدت زمان بیش تری بدون منجمد کردن نگه داری کرد. این به نفع گونه هایی است که اسپرم آن ها پس از انجماد زنده مانی کم تری داشته و فقط برای مدت چند روز در شرایط مایع می توان نگه داری کرد. در این میان بیش تر به ترکیباتی تحت عنوان گلیکان ها در اپی تلیوم اویدوکت و پروتیین های اتصالی اسپرم به این گلیکان ها اشاره شده است.با بررسی های انجام شده و با توجه به این که در برخی از گونه ها اسپرم ها برای مدت طولانی در دستگاه تناسلی ماده ذخیره شده و حتی بدون حضور جنس نر نیز امکان تولید نتاج دارند، می توان امیدوار بود با مطالعه مکانیسم های دخیل و بدون منجمد کردن، در حفظ ذخایر ژنتیکی برتر و نگه داری اسپرم گونه های در حال انقراض، افق های روشن تری گشوده شود.

    کلید واژگان: اسپرم، اویدوکت، مخازن اسپرم، نگه داری بلندمدت
    M .Nazari, H. Daghighkia

    Aim Considering that significant progress has been made in the field of cryopreservation and long- term storage of sperm in different species, but this process causes significant damage to the sperm cell. In this article, we have tried to review the studies related to sperm storage tanks in poultry and their role in sperm function. The researchers concluded that with a proper understanding of how sperm is stored in the oviduct, sperm can be stored for longer without freezing. This is in favor of species whose sperm have a shorter viability after freezing and can only be stored in liquid conditions for a few days. Compounds called glycans in the epithelium of the oviduct and sperm binding proteins to these glycans are more commonly referred to. In this review, information about sperm storage tanks, the role of these tanks in sperm function, glycans were studied in mammals from google scholar, pub med, andrology, reproduction of domestic animals and biology of reproduction. By studies of these contents, we conclude that in some species, sperm are stored for a long time in the female reproductive system and are able to produce offspring without the presence of males, by carefully studying the mechanisms involved and being inspired by these events, we can succeed in preserving superior genetic resources and preserving the sperm of endangered species without freezing.

    Keywords: Glycans, Sperm reservoirs, oviduct, Cell binding
  • مطالعه حاضر در قالب طرح فاکتوریل 2×2 بمنظور بررسی تاثیر استرس (با تجویز و یا بدون تجویز دگزامتازون) و تغذیه سلنیوم (با و بدون مکمل سازی جیره ای) بر کیفیت اسپرم منجمد-یخ گشایی شده در پرندگان نر مادر گوشتی انجام شد. تعداد 24 قطعه خروس مادر گوشتی با سن 28 هفته بطور تصادفی به 4 تیمار (فاکتوریل 2×2) و6پرنده در هر تیمار تقسیم شدند. تیمارهای آزمایشی عبارت بودند از 1) جیره پایه ای بدون مکمل سازی سلنیوم و تزریق محلول سرم فیزیولوژیکی (CON)، 2) جیره پایه با تزریق دگزامتازون(4 میلی گرم به ازای کیلوگرم وزن بدن، یک روز در میان برای مدت یک هفته)(DEX)، 3) بدون تزریق دگزامتازون و جیره پایه مکمل شده با 3/0 میلی گرم سلنیوم آلی از منبع سلپلکس در کیلوگرم خوراک (Sel-Plex) و 4) تجویز دگزامتازون و جیره پایه مکمل شده با 3/0 میلی گرم سلنیوم آلی از منبع سلپلکس در کیلوگرم خوراک (Sel-Plex+Dex). نمونه های اسپرم از پرندگان جمع آوری شد. تحرک کل و پیش رونده، پیوستگی غشای پلاسمایی، زنده مانی، غلظت مالون دی آلدهید و فرآسنجه های آنتی اکسیدانی در اسپرم تازه و منجمد-یخ گشایی شده ارزیابی شدند. علی رغم تاثیرات متقابل غیرمعنی دار، آنالیز فاکتوریل اثرات ساده معنی داری را از فاکتورهای آزمایشی در بررسی فرآسنجه های مختلف آزمایشی در اسپرم تازه و منجمد شده نشان داد(05/0>p). نتایج نشان داد که تحرک کل و پیش رونده، پیوستگی غشای پلاسمایی و زنده مانی در گروه دگزامتازون پایین تر از سایرین بود(05/0>p). از طرف دیگر غلظت مالون دی آلدهید در گروه مذکور نسبت به گروه های دیگر بالاتر بوده (05/0>p) و علاوه بر این که ظرفیت کل آنتی اکسیدانی، غلظت گلوتاتیون پراکسیداز و سوپراکسید دیسموتاز در گروه دگزامتازون پایین تر از سایر تیمارها بود(05/0>p). نتایج نشان داد که مصرف سلنیوم در گروه دریافت کننده دگزامتازون فراسنجه های مختلف را در اسپرم تازه و منجمد-یخ گشایی شده بهبود داد؛ اما بهترین نتایج در گروه Sel-Plex مشاهده شد(05/0>p). بنابراین تجویز سلنیوم در جیره خروس های بدون تزریق دگزامتازون تحرک کل و پیش رونده، پیوستگی غشای پلاسمایی، زنده مانی، غلظت مالون دی آلدهید، گلوتاتیون پراکسیداز، سوپراکسید دیسموتاز و ظرفیت آنتی اکسیدانی کل را در اسپرم پس از انجماد بهبود داد. بطور کلی نتیجه گیری می شود که استفاده شکل آلی سلنیوم در خوراک خروس های تحت استرس فیزیولوژیک ویا بدون استرس فرآسنجه های حرکتی و آنتی اکسیدانی را در اسپرم های تازه و منجمد-یخ گشایی شده بهبود می دهد.

    N Kamrani, A Karimi *, M Nazari, R Masoudi

    Current experiment was carried out in factorial 2×2 arrangement to study the effects of stress (with or without dexamethasone administration) and addition of dietary selenium (with or without selenium supplementation in the diet) in male broiler breeder on the quality of frozen-thawed sperm under oxidative stress induced by dexamethasone. A total of 24 broiler breeder roosters with the age of 28 weeks were used based on a completely randomized design with four therapeutic approaches (factorial 2×2) and six birds in each approach. The experimental treatments were: 1) basal diet without selenium supplementation and injection of saline (CON), 2) basal diet with dexamethasone injection (4 mg/kg BW, three times every other day for one week), (DEX), 3) without dexamethasone injection and supplementation with 0.3 mg/kg selenium (Sel-Plex), and 4) dexamethasone injection and basal diet supplemented with 0.3 mg/kg of diet selenium (Sel-Plex+Dex). Sperm samples were collected from roosters. Motility, progressive motility, plasma membrane integrity, viability, malondialdehyde concentration and antioxidant parameters were evaluated in fresh and frozen-thawed semen. In spite of non-significant interaction effects, factorial analysis indicated the significant effect of every factor on different experimental parameters in fresh and frozen-thawed semen (P<0.05); The results revealed that total and progressive motility, plasma membrane integrity and viability were lower in DEX group when compared with other treatments (P<0.05). On the other hand, malondialdehyde concentration was higher in DEX group in comparison with Con, Sel-Plex and Sel-Plex+DEX groups (P<0.05). Moreover, total antioxidant capacity, level of glutathione peroxidase and superoxide dismutase were lower in DEX group as compared with other treatments (P<0.05). Our findings indicated that administration of selenium in dexamethasone-receiving roosters (Sel-Plex+DEX) improved the parameters of fresh and frozen-thawed sperm; but the best results were observed in Sel-Plex treatment. Therefore, selenium supplementation in the diet of roosters without dexamethasone injection improved total motility, progressive motility, membrane integrity, viability, malondialdehyde, total antioxidant capacity, glutathione peroxidase and superoxide dismutase pre- and post-freezing. It can be concluded, selenium in organic forms in stressed and non-stressed rooster's diet might improve all motility and antioxidant parameters in fresh and frozen-thawed sperm.

    Keywords: Frozen-thawed sperm, Motility parameters, Physiological stress, Sel-Plex
  • محمود نظری*، غزال محمدی اهوازی

    خلوص ژنتیکی نژادهای گوسفند با توجه به تلاقی های کنترل نشده رو به کاهش است به همین علت حفظ تنوع زیستی در نژادهای بومی به عنوان یک سرمایه ملی ضرورت دارد. بنابراین هدف از انجام این پژوهش بررسی تنوع ژنتیکی و فیلوژنتیکی ناحیه HVR I D-loop ژنوم میتوکندری، بین سه نژاد گوسفند تالشی، شال و ماکویی بود. جهت انجام آنالیزها از توالی های ناحیه D-loop میتوکندری سه نژاد تالشی، شال و ماکویی ذخیره شده در بانک اطلاعاتی NCBI استفاده شد. تنوع نوکلیوتیدی برای نژاد تالشی، شال و ماکویی به ترتیب 04160/0، 04552/0 و 04422/0 و تنوع هاپلوتایپی در هر سه نژاد 00/1 برآورد شد. همچنین نتایج تجزیه واریانس مولکولی (AMOVA) حاکی از آن بود که تنوع درون جمعیت ها 100 درصد و تنوع بین جمعیت ها صفر درصد بود. این نتایج بیانگر وجود تنوع بسیار بالا در این نژادها می باشد. محاسبه D تاجیمای منفی برای نژاد تالشی بیان کننده این موضوع است که جمعیت نژاد تالشی بعد از گذراندن یک تنگنای ژنتیکی در حال گسترش است و انتخاب جهت دار در حال انجام است. در حالی که محاسبه D تاجیمای مثبت برای دو نژاد شال و ماکویی نشان می دهد که این دو جمعیت در حال گزینش متعادل کننده هستند. با رسم درخت فیلوژنتیک به روش NJ مشخص گردید هر سه نژاد گوسفند در گروه هاپلوتایپی D قرار دارند. از قرارگیری این نژادها در گروه نژادهای قفقاز و ترکیه می توان نتیجه گرفت که این سه نژاد از نژادهای قدیمی و باستانی هستند و باید جهت حفظ این سرمایه های ملی تلاش بیشتری کرد.

    کلید واژگان: تنوع ژنتیکی، HVR I، درخت فیلوژنتیک، ژنوم میتوکندری، گوسفند
    M .Nazari *, Gh .Mohamadi Ahvazi

    The genetic purity of sheep breeds is declining due to uncontrolled crossbreeding, so it is essential to preserve biodiversity in native breeds as a national asset. Therefore, the purpose of this study was to investigate the genetic and phylogenetic diversity of the mitochondrial HVR I region between the three Taleshi, Makui and Shal breeds. For this purpose, HVR I sequences of these three breeds were downloaded from NCBI database. Nucleotide diversity for Taleshi, Shawl and Makui breeds calculated 0.0416, 0.04552 and 0.04422, respectively, and haplotype diversity in all three breeds was estimated to be 1.00. In addition, the results of molecular analysis of variance (AMOVA) showed that the diversity within populations was about %100 and in fact the total diversity was included and the diversity between populations was %0. These results indicated high genetic variation in three sheep breeds. Negative Tajima''s D for Taleshi breed indicated that the this population is expanding after going through a recent bottleneck and selection sweep is in progress, while positive Tajima''s D for shawl and Makui breeds demonstrated that these two populations are balancing selection. The NJ phylogenetic test results indicated that all three breeds of sheep were classified into haplotype D. From the classification of these breeds with the Caucasian and Turkish breeds in one branch, it can be concluded that these three breeds are the ancient breeds of sheep and more efforts should be made to preserve these national assets.

    Keywords: Genetic diversity, HVR I, Phylogenetic tree, Mitochondrial genome, Sheep
  • فاطمه بانکی زاده*، هدایت الله روشنفکر، محمدحسین بنابازی، محمود نظری، رضا صفری

    اسپلایسووزم یک کمپلکس بزرگ ریبونوکلیوپروتیینی است، که فرآیند پیرایش mRNAی پیش ساز را در سلول های یوکاریوتی هدایت می کند. در مطالعه حاضر پروفایل ترانسکریپتوم هیپوفیز بوقلمون مادر تجاری از نژاد بیوتی طی مراحل تخم گذاری و کرچی مورد بررسی قرار گرفت. تعداد 334 ژن با بیان متفاوت بین دو گروه تشخیص داده شد، که 229 ژن دارای بیان زیاد و 105 ژن دارای بیان کم در گروه تخم گذار در مقایسه با گروه کرچ مشاهده شد. در این مطالعه نتایج تجزیه و تحلیل هستی شناسی و KEGG نشان داد که ژن های مسیر اسپلایسوزوم نقش موثری در مرحله انتقال از تخم گذاری به کرچی بوقلمون ها داشتند (05/0>P). علاوه بر این در مسیر انتقال یون کلسیم در بخش عملکرد مولکولی، فرآیند پیرایش باعث فعال شدن و ایجاد ایزوفرم های مختلف ژن مربوط به کلسیم -کالمادولین وابسته به پروتیین کیناز دو آلفا شد، که نقش مهمی در سیستم نوروترانسمیتری و هورمونی دارد. در این مطالعه نشان داده شد که، ژن های SNRPD1، SNRPF و SNRPA1 مربوط به کمپلکس اسپلایسوزوم برای ساخت فولیکول ها و باروری ضروری هستند. ژن HSPA8 نیز که در بوقلمون های تخم گذار نسبت به کرچ بیان کمتری داشت، در اتوفاژی و تخریب فولیکول ها در بوقلمون های کرچ نقش داشت.

    کلید واژگان: اسپلایسوزوم، هیپوفیز، کرچی، تخمگذاری، بیان ژن
    F .Bankizadeh *, H. Roshanfekr, M.H .Banabazi, M. Nazari, R. Safari

    The spliceosome is a large ribonucleoprotein complex that guides pre-mRNA splicing in eukaryotic cells. In this research, pituitary transcriptome profile of commercial breeder turkey of BUT breed was studied during the laying and broodiness phases. A total of 334 differentially expressed genes during egg-laying phases and brooding phases were identified. There were 229 upregulated and 104 downregulated at egg-laying phases compared with brooding phases. In the present study results of both GO and KEGG analysis suggested that the genes in the spliceosome complex are critical in the transition from the egg-laying to brooding phase turkeys. In addition, in the calcium ion transport in the biological process, splicing activates and creates various isoforms of the calcium/calmodulin alpha, which plays an important role in the neurotransmitter and hormonal systems of turkeys. In this study it was revealed that SNRPD1, SNRPF and SNRPA1/U2A in spliceosome complex were essential for folliculogenesis and fertility. HSPA8 wassignificantly down-regulated at laying turkeys compared with broodiness turkeys was involved in autophagy and follicular regression in broody turkey.

    Keywords: Spliceosome, Pituitary, Broodiness, Egg-Laying, Gene expression
  • اقبال یاوری، جمال فیاضی، محمود نظری*، خلیل میرزاده

    ژن DGAT1 با کد کردن آنزیم دی آسیل گلیسرول آسیل ترانسفراز (DGAT1) نقش اصلی را در ساخت تری گلیسیرید و چربی شیر دارد. تحقیقات اخیر نشان داده که چندشکلی در ژن DGAT1 بر صفت تولید شیر موثر است. لذا هدف از این تحقیق بررسی چندشکلی اگزون 14 ژن DGAT1 در شترهای تک کوهانه خوزستان با استفاده از روش چندشکلی شکل فضایی رشته های منفرد (SSCP) بود. برای انجام این آزمایش از 80 نفر شتر تک کوهانه خونگیری به عمل آمد. پس از استخراج DNA، یک قطعه 310 جفت بازی از اگزون 14 ژن DGAT1 با استفاده از واکنش زنجیره پلی مراز (PCR) تکثیر گردید. در این مطالعه 6 الگوی باندی متفاوت به عنوان شش ژنوتیپ متفاوت شامل AA، AB، BB، CC، DD و EE به ترتیب با فراوانی های 45 ، 75/33 ، 5، 75/3 ، 5/2 و 10 درصد و پنج نوع آلل A، B، C، D و E به ترتیب با فراوانی های 619/0، 219/0، 038/0، 025/0، 1/0 شناسایی گردید. بعلاوه، آزمون کای مربع نشان داد که جمعیت در این جایگاه در تعادل هاردی- وینبرگ قرار ندارد. تعداد آلل موثر، شاخص شانون، هتروزیگوسیتی مورد انتظار و مشاهده شده برای این جایگاه به ترتیب 259/2، 07/1، 557/0 و 338/0 محاسبه گردید. این نتایج نشان دهنده ی وجود چندشکلی است اما نشان می داد که میزان هتروزیگوسیتی در جمعیت مورد مطالعه کم است. پیشنهاد می گردد با تدوین برنامه های اصلاح نژادی مناسب تنوع موجود در جمعیت شتر تک کوهانه خوزستان افزایش داده شود.

    کلید واژگان: چند شکلی، DGAT1، SSCP، شتر تک کوهانه
    E. Yavari, J. Fayazi, M Nazari *, Kh. Mirzadeh

    The Diacylglycerol O-Acyltransferase 1 (DGAT1) gene plays a key role in the production of triglycerides and milk fat by encoding the enzyme DGAT1. Recent research has shown that polymorphisms in the DGAT1 gene affect milk production. Therefore, the aim of this study was to investigate polymorphism in exon 14 region of DGAT1 gene in Khuzestan dromedary camels (Camelus dromedarius) using PCR-SSCP method. To perform this experiment, blood samples were collected from 80 dromedary camels in Khuzestan province. After DNA extraction, a 310-bp fragment of exon 14 region of DGAT1 gene was amplified using polymerase chain reaction (PCR). Six different SSCP patterns, including six different genotypes of AA (45%), AB (33.75%), BB (5%), CC (3.75%) , DD (2.5%) and EE (10%) and five alleles including A (0.619), B (0.219), C (0.038), D (0.025) and E (0.1) were identified. Moreover, the chi-square (χ2) test showed that the population was not in Hardy-Weinberg equilibrium. The number of effective alleles, Shannon index, expected and observed heterozygosity for this site was calculated 2.259, 1.07, 0.557 and 0.338, respectively. The results indicated polymorphism and low heterozygosity in the population under study. It is suggested to increase the diversity in the dromedary camel population of Khuzestan by developing appropriate breeding programs.

    Keywords: Polymorphism, DGAT1, SSCP, Dromedary Camel
  • حسن چنانی، محمود نظری*، محمدتقی بیگی نصیری، هدایت الله روشنفکر، علی آقایی

    ژن DMB2 یکی از ژن های خوشه MHC است که در پاسخ ایمنی همورال نقش ایفا می کند. این تحقیق جهت شناسایی چندشکلی ناحیه اگزون 2 ژن MHC-DMB2 و ارتباط آن با پاسخ ایمنی همورال در بلدرچین ژاپنی انجام گرفت. بدین منظور در روز 28 دوره پرورش، مقدار 2/0 میلی لیتر محلول پنج درصد گلبول قرمز خون گوسفندی (SRBC) به عضله سینه 130 بلدرچین ژاپنی (65 نر و 65 ماده) تزریق شد و هفت روز بعد در روز 35 دوره پرورش، خون گیری جهت تعیین تیتر آنتی بادی علیه SRBC  انجام شد. DNA ژنومی از نمونه های خون استخراج شد و قطعه ای به اندازه 333 جفت باز از این جایگاه با استفاده از واکنش زنجیره ای پلی مراز (PCR) تکثیر شده و محصولات PCR به وسیله آنزیم برشی Hinf I هضم شدند. نتایج حاصل حاکی از وجود دو نوع آلل C (333 جفت بازی) و آلل G (226 و 107 جفت بازی) در این جایگاه بود که فراوانی آن ها در کل جمعیت به ترتیب 6/74 و 4/25 درصد محاسبه شد. نتایج نشان دهنده وجود چندشکلی و میزان هموزیگوسیتی بالا در جمعیت مورد مطالعه است. به علاوه، نتایج نشان داد که ژنوتیپ اثر معنی داری بر تیتر آنتی بادی دارد (01/0 <p). ژنوتیپ CC بیشترین (13/2 میلی گرم بر دسی لیتر) و ژنوتیپ GG کمترین تیتر آنتی بادی کل (33/0 میلی گرم بر دسی لیتر) را نشان داد. پیشنهاد می شود آثار منفی این چندشکلی تک نوکلیوتیدی در برنامه های اصلاح نژادی در نظر گرفته شود.

    کلید واژگان: ایمنی همورال، بلدرچین ژاپنی، چندشکلی، ژن DMB2، PCR-RFLP
    H. Chenani, M. Nazari *, M. T. Beigi Nassiri, H. Roshanfekr, A. Aghaei

    The DMB2 gene is one of the MHC cluster genes that plays a role in the humoral immune response. This study was performed to identify the polymorphism of exon 2 of the MHC-DMB2 gene and its association with the humoral immune response in Japanese quail. For this purpose, on day 28, 0.2 mL of 5% saline suspension of sheep red blood cell (SRBC) was injected into 130 quail's breast muscle (65 males and 65 females). Seven days later, cervical vein blood sampling was performed on the 35th day. Afterward, the anti-SRBC titer antibody was determined using a micro hemagglutination technique. Also, genomic DNA was extracted from blood samples and a 333bp fragment of exon 2 was amplified using polymerase chain reaction and PCR products were digested by Hinf 1 restriction enzyme. The results showed that there were two types of C (333bp) and G (226, 107bp) alleles in this region with a frequency of 74.6% and 26.4% in the whole population, respectively. The results indicate high polymorphism and high homozygosity in the studied population. In addition, the results showed that genotype had a significant effect on antibody titers (P<0.01). The CC genotype showed the highest total antibody titer (2.13 mg/dL) and the GG genotype showed the lowest total antibody titer (0.33 mg/dL). It is suggested that the negative effects of this single nucleotide polymorphism be considered in breeding programs.

    Keywords: Humoral immunity, Japanese quail, Polymorphism, DMB2 gene, PCR-RFLP
  • مهدی نظری، حسین دقیق کیا، ابوذر نجفی
    هدف

    این پژوهش به منظوره بررسی اثرات حفاظتی افزودن سطوح مختلف ویتامین A به رقیق کننده اسپرم قوچ طی نگه داری اسپرم تا زمان تعادل و قبل از انجماد در دمای سردسازی  و انجماد و یخ گشایی بود.

    مواد و روش ها:

     در این مطالعه، نمونه های اسپرم از 4 راس قوچ، به وسیله واژن مصنوعی جمع آوری شد، پس از ارزیابی اولیه، نمونه ها در صورت نرمال بودن باهم مخلوط شده و پس از رقیق سازی سطوح 5، 10، 15 و 20 میکرومول ویتامین A به نمونه ها افزوده شده و نمونه ها پس از 2 ساعت سردسازی، منجمد شدند. فرآسنجه های تحرک، زنده مانی، سلامت غشای پلاسمایی و ریخت شناسی اسپرم در دو مرحله (قبل از انجماد و بعد از انجماد) و هم چنین میزان مالون دی آلدهید بعد از انجماد و یخ گشایی اندازه گیری شد.

    نتایج

    نتایج به دست آمده نشان داد که افزودن سطوح مختلف ویتامین A به محیط رقیق کننده طی سردسازی تاثیر معنی داری روی فراسنجه های مورد ارزیابی نداشت (05/0>p)، نتایج بعد از انجماد نشان داد افزودن سطح 15 میکرومول باعث افزایش تحرک کل (TM)، تحرک پیش رونده (PM)، سرعت اسپرم در خط مستقیم (VAP) و سرعت در مسیر مستقیم اسپرم (VSL) شد (05/0>p). در رابطه با سلامت غشا، و زنده مانی، سطح 15 میکرومول سبب افزایش معنی دار شد و در همین سطح کاهش میزان اسپرم هایی با ریخت شناسی ناسالم و میزان مالون دی آلدهید نسبت به گروه کنترل مشاهده شد (05/0>p).

    نتیجه گیری:

     باتوجه به نتایج حاصل، افزودن سطوح مختلف ویتامین A، سطح 15 میکرومول توانست بهترین عمل کرد را در بهبود فراسنجه های مورد ارزیابی داشته باشد و تنش های اکسیداتیو را طی انجماد و یخ گشایی کاهش بدهد.

    کلید واژگان: آنتی اکسیدانت، اسپرم قوچ، تنش اکسیداتیو، ویتامین A
    M. Nazari, H .Daghighkia, A .Najafi
    Aim

    This study aimed to investigate the protective effects of different levels of vitamin A on ram sperm diluent during storage until equilibrium and before cryopreservation at 4 °C and freeze-thawing.

    Material and Methods

    In this study, 4 Ghezel rams were used for semen collection by the artificial vagina. After the initial evaluation, the samples with normal properties were pooled and after the dilution process, 0, 5, 15, and 20 µmol vitamin A were added to the samples and frozen after 2 hours of cooling. Parameters of motility, viability, plasma membrane integrity, and sperm morphology were evaluated in two steps (before and after cryopreservation) as well as malondialdehyde levels after freeze-thawing.

    Results

    The results showed that the addition of different levels of vitamin A to the extender during cooling at 4 °C had no significant effect on the evaluated parameters (P <0.05). The results after freezing showed that a level of 15 µmol of vitamin A increased the total motility, progressive motility (PM), VAP, and VSL (P <0.05). Plasma membrane integrity and viability increased significantly at the level of 15 µmol and also adding 15 µmol levels to the freezing medium decreased the amount of sperm with abnormal morphology and the amount of malondialdehyde compared to the control group (P <0.05).

    Conclusion

    According to the results of adding different levels of vitamin A, the level of 15 µmol has the best performance in improving the evaluated parameters and reduces oxidative stress during cryopreservation and thawing.

    Keywords: Antioxidant, Oxidative stress, Sperm, Vitamin A
  • M. Nazari*, E. Movahed, M. Soltaninejad
    Aims

    The hospital is the first center to fight the Covid-19. This study aimed to investigate the preparedness and resilience of hospitals in the South of Kerman province, Iran.

    Instrument & Methods

    This descriptive study was conducted on 77 members of the Crisis Committee in 7 hospitals in the south of Kerman province that was covered by Jiroft University of Medical Sciences from April 2020 to Mar 2021. The data collection tool was standard preparedness and resilience questionnaires. Data were analyzed by Pearson correlation coefficient and Chi-square using SPSS 25 software.

    Findings

    The most and lowest frequency of preparedness related to identifying and managing patients and facility communications by 54.9% and 1.2%. Overall, 43% of the preparedness was complete, 52% progressed, and 3% were not yet started. Also, the mean scores of resilience were 194.37±41.40, which was higher than average. The rate of the "Key vulnerabilities" component (70.47±16.68) in the resilience was higher than the other components. Finally, the Pearson correlation coefficient indicated no relation between preparedness and resilience (p>0.05).

    Conclusion

    Although hospital resilience was moderate, the hospital readiness was at a low level; thus, we should improve the health system to help to improve the continuing education program, psychological support, and planning and decision making to control the crisis of the covid-19 epidemic.

    Keywords: Preparedness, Resilience, Covid-19, Hospital, Iran
  • معصومه غلامی اکبرآباد*، محمدرضا قاسمی، علی اصغر شکری، علیرضا گراییلی کرپی، محمد نظری

    استفاده از شتابدهنده های الکترواستاتیک الکترونی با انرژی متوسط به دلیل بازدهی بالا و قیمت مناسب در صنعت کاربرد بسیار زیادی دارند. در شتاب دهنده الکترواستاتیک، ستون شتابدهی نقش تقسیم پتانسیل پایانه ولتاژ بالا را دارد به طوری که در یک مسیر مستقیم، باریکه را به صورت گام ای شتاب می دهد. در این مقاله یک ستون شتاب دهی 500 کیلوولت توسط نرم افزار CST Studio Suite طراحی شده است. در این طراحی از تفنگ الکترونی با کاتد مسطح و جریان 50 میلی آمپر استفاده شده است. به منظور استخراج باریکه از تفنگ الکترونی، از دو الکترود فیلتر و الکترود لنز، به ترتیب با ولتاژ 495  و481 کیلوولت و جهت شتاب دهی الکترون،13 الکترود با گام پتانسیل 37 کیلوولت طراحی شده است. برای نگهداری الکترودها و جلوگیری از تخلیه بار الکتریکی بین الکترودها، صفحات عایقی از جنس پیرکس در نظر گرفته شده است. در انتهای ستون شتاب دهی، جریان باریکه 50 میلی آمپر، شعاع کمر باریکه کمتر از 5/0میلی متر، گسیلندگی باریکه 73 نانومتررادیان و پروه انس باریکه 15/0  میکروپرو به دست آمد. ابعاد ستون شتاب دهی و نتایج حاصل از بررسی تغییر شعاع داخلی الکترودها، جابه جایی و انحراف زاویه ای الکترود اول نسبت به محور ستون شتاب دهنده در این مقاله ارایه شده است.

    کلید واژگان: شتاب دهنده الکترواستاتیک، ستون شتاب دهی، تغییر شعاع الکترود، نرم افزار CST Studio Suite ‏
    M. Gholami Akbarabad *, M. R. Ghasemi, A. Shokri, A. Grayli, M. Nazari

    Due to their high efficiency and low ‎cost, electrostatic electron accelerators with a moderate energy,  are used in the industry. In an electrostatic accelerator, the acceleration tube plays the role of dividing ‎the potential of the high-voltage terminal so that it accelerates the beam incrementally in a straight line. In this ‎paper, an acceleration tube for a Dynamitron accelerator with a voltage of 500 kV is designed by CST Studio ‎Suite software. In this design, an electron gun with flat cathode, and a current of 50 mA was used.  In order to ‎extract the beam from the electron gun, two filters are used: electrodes and the lens electrode, with voltages of 495 and ‎‎481 kV, respectively; besides for electron acceleration, 13 electrodes with a potential step of 37 kV have been ‎designed. To hold the electrodes and prevent electrical discharges between the electrodes, insulating ‎sheets made of Pyrex are used. At the end of the acceleration tube, a 50mA beam current, a waist radius of less than 0.5 ‎mm, a 73nm radian emittance, and a 0.15μperv beam were obtained. The dimensions of the acceleration tube ‎and the results of investigating the change in the radius of the electrodes, the displacement and deviation of ‎the angles of the first electrode relative to the axis of the acceleration tube are presented in this paper‎.‎

    Keywords: electrostatic ‎‏ ‏accelerator, acceleration‏ ‏‎ tube, electrode radius change, CST Studio Suite software
  • نسترن عباسی، حبیب اکبرزاده بنگر*، ابوذر جعفری، مریم نظری

    استفاده از دیوارهای گهواره یی به عنوان یک جایگزین در جهت رفع برخی نواقص لرزه یی دیوارهای برشی همانند خسارت چشم گیر در پایه و تغییرمکان ماندگار، با استقبال گسترده یی روبرو شده است. علی رغم کارهای آزمایشگاهی مختلف درخصوص عملکرد لرزه یی دیوارهای گهواره یی، تاکنون مدلی تحلیلی، که رفتار غیرخطی آن را تحت زلزله پیش بینی و میزان خسارت در سطح دیوار را مشخص کند، ارایه نشده است. هدف از پژوهش حاضر، ارایه ی روشی کاربردی جهت مدل سازی و تخمین خسارت دیوارهای گهواره یی با کابل های پس کشیده تحت بارگذاری لرزه یی است. بدین منظور جهت مدل سازی دیوار گهواره یی از نرم افزارPerform3D استفاده شده است. جهت اطمینان از صحت مدل سازی، نتایج آزمایشگاهی با نتایج تحلیلی مقایسه شده اند، که مدل پیشنهادی به خوبی می تواند رفتار غیرخطی دیوار گهواره یی را تحت زلزله پیش بینی کند. همچنین با استفاده از شاخص خرابی، میزان خسارت وارده به دیوار با بهره گیری از نتایج مدل سازی برآورد شده است، که مقایسه ی بین خرابی برآورد شده و دیوار آزمایشگاهی انطباق بالایی را نشان داده است.

    کلید واژگان: دیوار گهواره یی مرکزگرای بتنی، کابل پس کشیدگی غیرچسبیده، مدل سازی رفتار غیرخطی، آزمایش میز لرزه یی، برآورد خسارت
    N. Abbasi, H. Akbarzadeh Bengar *, A. Jafari, M. Nazari

    Application of self-centering rocking walls is now widely accepted as a viable alternative to removal of some of the common seismic defects of conventional shear walls including residual drift and significant damage to the base of walls. Despite the different experimental studies on the seismic performance of rocking walls, few numerical models have been developed to predict the seismic response and damage extent of these walls under seismic loading. The main objective of this study was to present a practical method for numerical modeling and damage estimation for nonlinear behavior of post-tensioned (PT) concrete rocking walls when exposed to earthquake excitations. To this end, PERFORM 3D software was utilized to model self-centering rocking walls. The walls were subjected to a set of seven spectrum compatible ground motions at different intensity levels. To ensure the accuracy of the modeling, the numerical results of the nonlinear analysis were compared with the experimental results, and the results showed that the developed model could predict the behavior of the wall during all ground motions with acceptable accuracy. Moreover, in this study, a damage index was employed to estimate the extent of damage in the developed numerical model. Good agreement between the observed damage in the shake table tests and estimated damage in the developed model was observed. The results of this study indicated that the method for modeling the seismic behavior of the rocking wall could appropriately predict the response and damage extent of these walls under earthquake loading.

    Keywords: self-centering concrete rocking walls, unbounded post-tensioned tendon, Nonlinear modeling, Shake table test, Damage estimation
  • M. Nazari, N. Mooraki, M. Sedaghati*

    Mahyaveh is an Iranian fermented fish sauce produced from fish, salt, spices and water during fermentation period. The main problem related to this product is very high histamine content of it. Effects of starter cultures (Lactobacillus plantarum and Paenibacillus polymyxa) on reduction of histamine in mahyaveh, as “Southern Iran Fermented Fish Sauce” were investigated. This study was performed in 4 experimental groups, including control and treatments on 30th and 45th days of the product. Chemical analysis of treated and control samples revealed that pH, salt percentage, TVB-N content decreased significantly (p<0.05), and acidity increased significantly (p<0.05) in treated samples compared to control samples. Also inoculate starter culture (Lactobacillus plantarum and Paenibacillus polymyxa) reduced the amount of histamine content to about 0.347 and 0.326 mg mL-1 from 0.473 and 0.368 mg mL-1 in control and treated samples, respectively. Results of microbial evaluation revealed that populations of Halophiles, Enterobacteriaceae and fungi decreased significantly in treated samples compared to those of control samples (p<0.05), but colony populations of Bacillus and LAB increased significantly in treated samples compared to those of control samples (p<0.05). In general, addition of starter culture had a positive effect in reducing the amount of histamine and improving other chemical properties and microbial quality of the fermented fish sauce.

    Keywords: Fish sauce, Histamine, Lactobacillus plantarum, Mahyaveh, Paenibacillus polymyxa
نمایش عناوین بیشتر...
سامانه نویسندگان
  • دکتر محمدعلی نظری
    دکتر محمدعلی نظری
    استاد علوم اعصاب، دانشگاه علوم پزشکی ایران، تهران، ایران
  • دکتر محسن نظری
    دکتر محسن نظری
    استاد مدیریت بازرگانی دانشکده مدیریت، دانشگاه تهران، تهران، ایران
  • دکتر محبوبه نظری
    دکتر محبوبه نظری
    دانشیار بیوتکنولوژی، پژوهشگاه فناوریهای نوین علوم زیستی- ابن سینا
  • محمدرضا نظری
    محمدرضا نظری

  • دکتر محمدعلی نظری
    دکتر محمدعلی نظری
    مربی علوم قرآن وحدیث، دانشگاه فرهنگیان، تهران، ایران
  • دکتر محمدحسین نظری
    دکتر محمدحسین نظری
    دانش آموخته دکتری گروه آسیب شناسی ورزشی و حرکات اصلاحی دانشگاه گیلان، دانشگاه گیلان
  • مهدی نظری
    مهدی نظری
    (1397) کارشناسی ارشد علوم تشریح، دانشگاه علوم پزشکی بقیه الله
  • دکتر مهدی نظری
    دکتر مهدی نظری
    دانشجوی دکتری دانشکده کشاورزی، دانشگاه تبریز، دانشگاه تبریز، تبریز، ایران
  • دکتر مهدی نظری
    دکتر مهدی نظری
    دانش آموخته دکتری دکتری مدیریت صنعتی، گروه مدیریت صنعتی، واحد تهران مرکزی، دانشگاه آزاد اسلامی، تهران، ایران، واحد تهران مرکزی، دانشگاه آزاد اسلامی، تهران، ایران
  • مهندس منصوره نظری
    مهندس منصوره نظری
    دانش آموخته ارشد فارغ التحصیل کارشناسی ارشد، پردیس ابوریحان، دانشگاه تهران، تهران، ایران
  • دکتر ملیحه نظری
    دکتر ملیحه نظری
    (1394) دکتری زمین شناسی، دانشگاه پیام نور
  • مهندس ملیحه نظری
    مهندس ملیحه نظری
    دانشجوی کارشناسی ارشد عمران، دانشگاه فردوسی، مشهد، ایران
  • مریم نظری
    مریم نظری
    پژوهشگر یادگیری و کنترل حرکتی، ایران. بجنورد
  • مجتبی نظری
    مجتبی نظری
    دانشجوی دکتری معماری، واحد همدان، دانشگاه آزاد اسلامی، همدان، ایران
  • معصومه نظری
    معصومه نظری
    دانش آموخته ارشد ایران شناسی، رشته اصول نسخه خطی، مرمت و کتاب آرایی، دانشگاه شهید بهشتی، تهران، ایران
  • مسعود نظری
    مسعود نظری

  • مریم نظری
    مریم نظری
    دانش آموخته ارشد الهیات- ادیان و عرفان، دانشگاه الزهرا، تهران، ایران
  • مریم نظری
    مریم نظری
    (1397) کارشناسی ارشد مدیریت خدمات بهداشتی درمانی، دانشگاه علوم پزشکی تهران
  • محمد نظری
    محمد نظری
    (1401) دکتری مدیریت آموزشی، دانشگاه آزاد اسلامی واحد کرمانشاه
  • مریم نظری
    مریم نظری
    (1400) کارشناسی ارشد آمایش شهری، دانشگاه بهشتی تهران
  • محبوبه نظری
    محبوبه نظری
    (1403) دکتری مدیریت بازرگانی، دانشگاه آزاد اسلامی واحد ساری
  • مهران نظری
    مهران نظری

  • معصومه نظری
    معصومه نظری
    دانش آموخته دکتری مدیریت صنعتی، واحد تهران جنوب، دانشگاه آزاد اسلامی، تهران، ایران
  • مهدی نظری
    مهدی نظری
    دانشجوی دکتری مهندسی صنایع، دانشگاه صنعتی مالک اشتر، تهران، ایران
  • مژگان نظری
    مژگان نظری

اطلاعات نویسنده(گان) توسط ایشان ثبت و تکمیل شده‌است. برای مشاهده مشخصات و فهرست همه مطالب، صفحه رزومه ایشان را ببینید.
بدانید!
  • در این صفحه نام مورد نظر در اسامی نویسندگان مقالات جستجو می‌شود. ممکن است نتایج شامل مطالب نویسندگان هم نام و حتی در رشته‌های مختلف باشد.
  • همه مقالات ترجمه فارسی یا انگلیسی ندارند پس ممکن است مقالاتی باشند که نام نویسنده مورد نظر شما به صورت معادل فارسی یا انگلیسی آن درج شده باشد. در صفحه جستجوی پیشرفته می‌توانید همزمان نام فارسی و انگلیسی نویسنده را درج نمایید.
  • در صورتی که می‌خواهید جستجو را با شرایط متفاوت تکرار کنید به صفحه جستجوی پیشرفته مطالب نشریات مراجعه کنید.
درخواست پشتیبانی - گزارش اشکال