m. nazari

Graphene quantum dots are a new member of the carbon family with various applications rapidly developing due to their unique properties. This research aims to obtain this valuable nanomaterial using a convenient, quick, and easy production method called carburizing. For this purpose, production from the primary source of glutamic acid was done at temperatures of 210, 220, and 230 ºC and times of 60 and 90 s. Next, the Raman test and fourier transform infrared spectroscopy, dynamic light scattering, photoluminescence, and ultraviolet-visible spectroscopy were performed to investigate the properties of graphene quantum dots of the product. The microstructure was examined by field emission escanning electron microscopy images. Also, the morphology of the surface and the distance between the planes were investigated by high resolution transmission electron microscopy. The results showed that the best sample in terms of distribution and particle size was production at 220°C for 60 s with 3 nm in particle size for over 45% of the particles. Moreover, the highest absorption intensity in this sample was appeard at the wavelength of 244 nm. An increase in the production time caused the graphene quantum dots to be coarser with greater dispersion in particle size distribution. Photoluminescence studies in the excitation wavelength range of 340-400 nm revealed the appearance of a strong peak in the sample produced at 220 ºC and calcination time 60 s at the excitation wavelength of 380 nm.

The sex of chickens considerably impacts production performance and economic benefits in poultry farming. Male birds cannot lay eggs and usually have a lower ratio of meat to feed than broilers. Male chicks are typically killed immediately after hatching since they are redundant in the industry and male chicks will neither be suitable for egg production nor meat production. Day-old male chicks in the laying hen industry are usually culled immediately after hatching. As a result, this issue has caused moral concerns in societies. Efforts are underway to develop technology for automatically determining the sex of chick embryos, aimed at establishing a stable and efficient poultry farming system. In large commercial hatcheries, the sexing of newly born chicks is generally accomplished by three different methods according to new hatching lines' vent, color, or feathers. However, these methods are still time- and labor-consuming. If sex can be identified at an early embryonic stage or even before incubation, male eggs could be used as feed components. Moreover, fewer eggs would need to be incubated, which would reduce feed space requirements, CO2 emissions, and energy consumption, which are all economically beneficial to farmers and the environment. In recent decades, researchers have used various in ovo sexing strategies in chicken eggs before hatching or incubation. Some invasive and noninvasive studies that have been conducted for in ovo sexing of chicken eggs can be divided into five major categories: (i) molecular-based techniques, (ii) spectral-based techniques (Raman spectroscopy, fluorescent, 3D X-ray), (iii) acoustic-based techniques, (iv) morphology-based techniques, and (v) volatile organic compound (VOC)-based techniques. Commercially applicable methods must be noninvasive, rapid enough for real-time applications, economically feasible, and ethically acceptable. An alternative method, to prevent the removal of day-old chicks, is a non-invasive method to determine the sex of the egg in the early stages of hatching before the development of the nervous system. Recently, Raman spectroscopy was reported to determine the sex of eggs at the incubation stage. Raman spectroscopy is based on the Raman effect, whereby when incident light (wavelength 750–850 nm) excites molecules in a tissue, the molecules reflect light at a different wavelength. The reflected light's wavelength is characteristic of various chemical components and allows the detection of the atheromatous plaque chemical synthesis. Raman spectroscopy is a powerful tool expected to revolutionize chick sex determination because it can provide information about biological molecules. Thus, Raman spectroscopy is suitable for analyzing living organisms, leading to its widespread adoption across various biological and medical applications. Therefore, resonance Raman spectroscopies have found application in blood analysis, with some studies exploring its utility in chick sexing. For this purpose, the present study was carried out to investigate the feasibility of determining the sex of Iranian native chicken embryos using the Raman spectroscopy. To carry out this research, 100 fertilized eggs of Iranian native chickens were used. The sex of the embryos was determined using Raman spectroscopy with a wavelength of 785 nm during the fourth day of incubation. Validation of this method was investigated using the polymerase chain reaction (PCR) technique. Sequence alignment of CHD-Z and CHD-W allele sequences amplified by PCR technique. The amplified DNA fragments were single and double DNA bands in the size of 461 bp for the CHD-Z and 322 bp for the CHD-W genes. The PCR was carried out using a PCR master kit with specific primers (the forward primer: 5′- TATCGTCAGTTTCCTTTTCAGGT -3′, the reverse primer: 5′- CCTTTTATTGATCCATCAAGCCT -3′). Thermal cycling conditions for DNA amplification were: 1 cycle of initial denaturation at 94°C for 5 minutes; 35 cycles comprising 30s at 94°C for the denaturation, 30s at 59°C for annealing, 30s at 72°C for the elongation; and a final extension cycle at 72°C for 5 minutes. The PCR products were analyzed by electrophoresis on 2.5% agarose gel against a DNA Ladder 100bp, and visualized using the safe staining on UV transilluminator. The data obtained from the Raman spectrometer was analyzed using the Origin software. The main indices used to study the data were the intensity of the Raman peaks and the ratio of the dominant peak intensity. Additionally, principal component analysis (PCA) was employed to identify any patterns in the data. To calculate PCA1 and PC2, the ratios of I769/I838 and I1141/I1251 peaks were considered, respectively. PCA analysis can choose features that have a greater impact on the final result, depending on the data and the scope of their changes. The result of PCR showed that one fragment with a length of 461 bp was amplified for male embryos (ZZ) and two fragments with lengths of 461 and 322 bp were amplified for female embryos (ZW(. The study found that there are differences in the intensity of Raman bands between genders. Males have higher intensity while females have lower intensity. Therefore, changes in Raman spectra intensity can be used to identify gender. Additionally, the candlestick chart of the data showed that median and average values for males were larger than for females. Furthermore, the results obtained from PCA analysis showed that the variance percentages for PC1 and PC2 were 53.69% and 46.31%, respectively. PC2 is more reliable as it has less deviation. Based on the results obtained from the study, it can be concluded that Raman spectroscopy is a reliable method for determining the gender of chicken embryos during incubation. This test is quick, accurate, and can be easily incorporated into the industry to determine the gender of embryos without resorting to the practice of killing day-old chicks. Not only is this method more ethical, but it also offers a high level of accuracy, making it an attractive alternative for the industry. In general, these results demonstrate the potential application of hematological traits in developing an automatic in ovo embryo sexing method through spectroscopic analysis.

This paper presents a novel approach for modeling and analyzing complex systems withuncertain data by using fuzzy calculus and time-fractional dierential equations. Specically,we propose the use of the fuzzy Atangana-Baleanu time-fractional derivative with non-singularkernels for fuzzy functions as a suitable fractional derivative type for the qualitative analysis offractional dierential equations in fuzzy space. Additionally, we provide a method for numer-ically solving fuzzy linear time-fractional equations in uid dynamics using the fuzzy Laplacetransform iterative method. The eectiveness and practical relevance of our proposed methodare demonstrated through concrete examples, including the fuzzy time-fractional Advection-Dispersion equation, the fuzzy time-fractional Navier-Stokes equation, and Couette ow .These examples showcase the potential of our method to address real-world problems in uiddynamics and provide a clear illustration of the solution steps involved. Our ndings high-light the importance of considering fuzzy calculus and time-fractional dierential equations inmodeling and analyzing complex systems with uncertain data.

Patient blood management reduces unnecessary transfusions to improve patients' health. Familiarity of physicians with this program is necessary to improve the outcomes of patients health. This study was conducted to evaluate the effect of education on the level of knowledge of residents in medical centers in Yazd, 2022-2023.

The study was a before and after quasi-experimental intervention. 57 medical residents participated. A 20 question questionnaire measured the residents' knowledge level in patient blood management before and after the education. The validity of the questionnaire was measured by a survey of experienced physicians in the management of patient's blood. Reliability with Cronbach's alpha test was 0.8. The data were analyzed using t and Paired-t tests in SPSS 20 software.

35 participants (61.4%) were women and 22 (38.6%) were men. Their mean age was 30.58 ± 5.45 years.The average knowledge scores were 9.38 ± 3.77 and 14.01 ± 3.50 before and after education, respectively (p < 0.001). The lowest response rate before instructions pertained to evaluation of patients' anemia before surgery and knowledge of autologous blood usage. The knowledge score had no significant relationship with age, sex, blood prescription history, and medical practice duration.

Conclusions  :

Education effectively increased the knowledge of residents. It is suggested to include hold targeted educational programs with emphasis on the areas of anemia management and the use of autologous blood, publish educational guides, and include transfusion medicine and the patient's blood management program in medical education curricula.

In this work, nanoparticles of the metal fuel Zirconium (Zr) and nanoscale oxidizer BaCrO4 are synthesized considering their unique nanoparticle characteristics like mixing homogeneity and high surface/volume ratio. Using the synthesized fuel and oxidizer, the pyrotechnic mixture of Zr/BaCrO4 was developed under 4 different conditions and analyzed in terms of the thermal behavior and burning rate. In the synthesis stage, the oxidizer nanopowder BaCrO4 was developed through precipitating Barium Nitrate and Chromate Potassium in the vicinity of Dodecyl benzene sulfonate sodium (DBSS) stabilizer. Also, Zr nanopowder was prepared using direct reduction of Zr (NO3)2 by N2H2 and was coated by a 4% Collodion. Then, the pyrotechnic mixture Zr/BaCrO4 was charged and pressed in the constructed combustion chamber. The burning rate of the mixture was captured by the direct footage of the combustion process using digital cameras with 60 frame-per-second capabilities. The fastest burning occurs when both the fuel and the oxidizer are nano-scaled. The thermal behavior of the mixture was studied using the simultaneous thermal analysis (STA) machine within the temperature range of 25 to 1000 °C. Results of the thermal analysis show that the thermal decomposition temperature of the Zr/BaCrO4 mixture in the micron size is higher than in the nano size and the amount of destruction is lower. Increasing the concentration of zirconium in the nano-size from 10 to 50% leads to a decrease in the decomposition temperature from 565 to 437 °C, while the pyrotechnic mixture destruction rate increases from 39% to over 63%.

Electrostatic accelerators use a constant potential difference to create a suitable electric field and accelerate ions and electrons. One of the most widely used electronic accelerators in the industry, the dynamitron accelerator uses a voltage multiplier circuit to generate the voltage required for acceleration. The capacitor elements of the voltage multiplier circuit in the dynamitron accelerator are constituted of semi-cylindrical electrodes located in a columnar array. The design of this column of electrodes, also known as the voltage multiplier column, is a complex process. It requires the study and simulation of electromagnetic fields and circuit models. The conceptual design of this structure is also complicated due to parameter interdependence. In this article, after a brief introduction to different parts of the dynamitron accelerator and details of voltage multiplier columns, a process for the conceptual design of the voltage columns of a dynamitron accelerator is presented.

The purpose of this research was to fabricate and investigate the properties of SiC-5TiB2 nano composites reinforced by gaphene quantum dot nanoparticles via pressure less sintering method. In this way, SiC, TiB2, and graphene quantum dot raw materials were used in nanometer dimensions. First, before performing any laboratory operations, experimental samples were designed using Minitab 14 software. The design was done by the Taguchi method according to the L9 array and the parameters of the amount of gaphene quantum dot amplification in three levels were set at 0.2, 0.6, and 1 wt.% and sintering temperatures were defined as 2000, 2100, and 2200°C. The sintering process was carried out at certain temperatures in argon atmosphere for 2 h. XRD, FESEM, FTIR and Raman spectroscopy were performed. Density, micro hardness, and fracture toughness measurements were used for further investigations of physical and mechanical properties. The microstructure of the samples was also observed to determine the fracture toughness mechanisms. The results showed that the parameter of the amount of reinforcement was in the first rank of influence and the sintering temperature was in the second rank, and the best results were obtained in the sample with the amount of 0.6 wt.% of gaphene quantum dot and the sintering temperature of 2100 °C, where hardness and fracture toughness values were obtained to be 27.7 GPa and 3.3 MPa.m1/2, respectively.

Harmful algal blooms caused by dinoflagellates have significant adverse effects on environmental and public health. This study aimed to investigate the effect of water physicochemical parameters on the annual cycle of epiphytic dinoflagellates in the northern Chabahar Bay coastal waters of the Oman Sea (Iran). The macroalgal samples with associated epiphytes were collected seasonally from 6 coastal sites in spring, summer, atumn 2019 and winter 2020. The water physicochemical parameters were measured, and the data were analyzed using a one-way ANOVA and the principal component analysis (PCA). Twelve potentially toxic dinoflagellate species from five genera were identified during the four sampling seasons. Amphidinium carterae with an average of 11.22% and A. operculatum with an average of 10.77% of the total abundance of epiphytic dinoflagellates were the dominant species, and Gambierdiscus australes showed an average of 6.48%.Based on the PCA, the abundance of certain species was found to be influenced by different environmental factors. The PCA revealed that NO2, NO3 and SiO4 values had the greatest impact at sites with high abundances of A. operculatum, Prorocentrum concavum, P. emarginatum, P. rhathymum and G. balechii. Furthermore, PO4 concentration had the greatest impact at the sites with high abundances of A. carterae, P. lima, Ostreopsis lenticularis, O. heptagona, G. balechii, G. toxicus, G. australes and Coolia monotis. The results obtained highlighted a significant impact of dissolved oxygen, pH, salinity, temperature and nutrients on the epiphytic dinoflagellate species abundances in the study area.

Leishmaniasis is a skin disease spread by mosquitos from infected animals or humans to healthy humans. It can have a negative effect on a patient’s quality of life. The purpose of this study was to assess the impact of PRECEDE model-based training of healthcare personnel on the preventive behavior of the disease in covered households in Larestan, Iran.
Materials &

This controlled semi-experimental study was done on the households served by comprehensive rural health centers in Larestan, Iran. First, two comprehensive health centers were randomly assigned to the intervention or control groups. Eighty covered households were divided into two groups. The intervention group's health workers received training in four face-to-face sessions. Health workers then trained the families who were covered by them. Both groups completed a researcher-made questionnaire before and two months after the intervention. The independent t-test, paired t-test, ANCOVA, and Cohen's D were used to analyze the data by SPSS 20 software at a significance level of less than 0.05.

The mean scores of predisposing factors, enabling factors, reinforcing factors, and behavior in the intervention group differed significantly from the control group after training, and the effect size of each construct indicated the effectiveness of training.

Training of health workers based on the PRECEDE model plays a significant role in adopting Leishmaniasis prevention behavior in people under their care.

In order to evaluate the quantitative and qualitative performance of spring bread wheat cultivars under different planting dates, an experiment was conducted in Gonbad Agricultural Research Station, Gonbad, Golestan province, Iran, during two cropping seasons (2020-2022) as split plot based on randomized complete block design (RCBD) with four replications. Seven planting dates (1 November, 11 November, 21 November, 1 December, 11 December, 21 December and 31 December) were placed in main plots and four bread wheat genotypes (Araz, Arman, Taktaz and N-93-9) were placed in subplots. The delayed planting led to a significant decrease in the length of the phenological stages and the grain filling period. The highest grain yield was obtained from the planting at 11 November (5813 kg ha-1), which was not significantly different from grain yield in 21 November (5788 kg ha-1) and 31 November (5641 kg ha-1) planting dates. In most of the agronomic traits, the delayed planting dates (21 December and 31 December) had significantly lower values than planting in 11 November, 21 November and 1 December. Mean comparison for interaction effect of planting date×cultivar showed that planting Arman cultivar in 11 November, Araz cultivar in 11 November, 21 November and 1 December, Arman cultivar in the 21 November and Taktaz cultivar in the 21 November led to the highest grain yield. In the three delayed planting dates (11 December, 21 December and 31 December), the grain yield of Taktaz and Araz cultivars was higher than other genotypes. Mean comparisons on the traits related to bread-making quality showed that the two delayed planting dates (21 December and 31 December) had higher values in terms of protein and wet gluten content, compared to the two early planting dates (1 November and 11 November). Taktaz cultivar had the highest bread-making quality, particularly because it indicated the highest protein and wet gluten content.

In the history of Persian literature, a series of writings are known by the general name of Majalis. These writings are the result of meetings and preaching circles of Sufis and jurists. The sermons and admonitions of the Sufis and the religious scholars from the pulpit are called "Majales-gooyi" and the written works that were created in this way either by the hands of the preachers themselves or by the hands of some disciples are called "Majales" and such a writing tradition is called "Majales-writing". To be in addition to introducing these works and their speakers, this research compares the spoken language of these two parliaments.

This article is based on library studies and is done in an analyticaldescriptive way.

In fact, Rumi's Majlis Sabe' is to some extent the echo of Masnavi's prelude. The exact time of writing Majlis Saba' is not known, but apparently it was written by Sultan Valad or Hessam al-Din Chalapi during a sermon, later it was reread according to the original form, some material was added to it, and perhaps it was passed down from Rumi's personal opinion, and probably himself too. It has had corrections and additions. The congregations are written in a fine suspension line and a fine pen, and the space between the congregations is written in a thick script. The photo version of Majalis is approximately 16 pages long, and except for the first page which has 32 lines and the last page which has 20 lines, all pages have 41 lines. Ancient sayings and allusions are written in 67 parts. But apparently, the number of councils should be less than this; What is the date of some assemblies in one day? Because the meetings that have the same objection date are not separate from each other. Therefore, the number of assemblies is not 67 but 22.

All seven Majalis Sab'e have started with Arabic sermons and almost all phrases at the beginning of each Majalis are Masjid. Majlis Sab'e is full of similes and allegories expressed in the sweet language of Rumi. Ancient assemblies are full of amazing images and pictures. Atigi speaks in a literary style and is one of the artists who, due to his genius, has expressed pristine and first-hand images.

Mathematical modeling of biological systems is one of the most desirable methods for studying the behavior of these biological phenomena. The development of mathematical models has always been important for simulating, controlling, and predicting phenomena. One of the advantages of mathematical models is their application in optimization. Solving cancer therapy as an optimal control problem aims to reduce the concentration of cancer cells in the treatment period. In this solution, an important aspect that was not considered in previous studies was the optimum drug concentration that significantly affected patients' clinical health. Due to this, the present study was carried out to obtain an optimal drug-prescribing protocol to minimize the concentration of cancer cells and the drug concentration. This Multi-objective problem has been solved, for the first time, using the NSWOA algorithm, and the results were compared with the NSGA-II algorithm. Pareto front curve obtained from both algorithms offers a set of the most optimal solutions. According to the criteria of treatment choice, one of these points is chosen as the drug administration protocol.

Colorectal cancer is a global health problem, but most of these patients are curable through early diagnosis. The present study aimed to investigate the effect of an educational intervention through a campaign on health anxiety and participation of middle-aged people (ages 50-70 years) in CRC screening based on the Health Belief Model in urban areas.

A quasi-experimental study was conducted on 390 people in age range 50-70 years in Parsian in 2021. The participants were selected using convenience sampling. Champion’s Health Belief Model Scale and Health Anxiety Questionnaire were used to collect data. The educational intervention was carried out in the form of a campaign through educational video clips and a banner for four weeks. Data analysis was done in SPSS 26 software using descriptive statistics and univariate analysis of covariance.

There was a significant difference between the intervention and control groups in terms of the mean scores of the Health Belief Model scale (knowledge, perceived severity, perceived sensitivity, perceived benefits, perceived barriers, perceived self-efficacy, and action guide) and the health anxiety questionnaire (consequences of disease and probability of disease) after the intervention (p<0.001).

The constructs of the Health Belief Model are good determinants of the action of high-risk individuals to undergo fecal occult blood testing. This highlights the necessity of implementing comprehensive educational programs focusing on the constructs of the Health Belief Model in this population.

Mathematical modeling plays an important role in designing and optimizing of heat transfer systems. Due to radiation heat transfer mode in a vacuum environment, the behavior of the system is very nonlinear. In this paper, a new nonlinear ODE model for a vacuum box heat chamber is developed which is suitable for online computation, and the validity of the model is investigated using an experimental set. A specific input is given to the both mathematical model and the experimental set. With some of this data, system parameters are extracted using the genetic algorithm. Then, the behavior of the mathematical model and the experimental system with the extracted parameters are compared using cycles that have not been used in optimization. The comparison shows the accuracy of the proposed mathematical model. Then, to examine the model more closely and to observe the effect of model parameters on system behavior, the Monte Carlo method was used to analyze the overall sensitivity of the model. For this purpose, Latin hypercube sampling and partial rank correlation coefficients have been used to rank the parameters. The results show that the thermal conductivity of insulators is the most important parameter affecting the behavior of the system.

Aim Considering that significant progress has been made in the field of cryopreservation and long- term storage of sperm in different species, but this process causes significant damage to the sperm cell. In this article, we have tried to review the studies related to sperm storage tanks in poultry and their role in sperm function. The researchers concluded that with a proper understanding of how sperm is stored in the oviduct, sperm can be stored for longer without freezing. This is in favor of species whose sperm have a shorter viability after freezing and can only be stored in liquid conditions for a few days. Compounds called glycans in the epithelium of the oviduct and sperm binding proteins to these glycans are more commonly referred to. In this review, information about sperm storage tanks, the role of these tanks in sperm function, glycans were studied in mammals from google scholar, pub med, andrology, reproduction of domestic animals and biology of reproduction. By studies of these contents, we conclude that in some species, sperm are stored for a long time in the female reproductive system and are able to produce offspring without the presence of males, by carefully studying the mechanisms involved and being inspired by these events, we can succeed in preserving superior genetic resources and preserving the sperm of endangered species without freezing.

Current experiment was carried out in factorial 2×2 arrangement to study the effects of stress (with or without dexamethasone administration) and addition of dietary selenium (with or without selenium supplementation in the diet) in male broiler breeder on the quality of frozen-thawed sperm under oxidative stress induced by dexamethasone. A total of 24 broiler breeder roosters with the age of 28 weeks were used based on a completely randomized design with four therapeutic approaches (factorial 2×2) and six birds in each approach. The experimental treatments were: 1) basal diet without selenium supplementation and injection of saline (CON), 2) basal diet with dexamethasone injection (4 mg/kg BW, three times every other day for one week), (DEX), 3) without dexamethasone injection and supplementation with 0.3 mg/kg selenium (Sel-Plex), and 4) dexamethasone injection and basal diet supplemented with 0.3 mg/kg of diet selenium (Sel-Plex+Dex). Sperm samples were collected from roosters. Motility, progressive motility, plasma membrane integrity, viability, malondialdehyde concentration and antioxidant parameters were evaluated in fresh and frozen-thawed semen. In spite of non-significant interaction effects, factorial analysis indicated the significant effect of every factor on different experimental parameters in fresh and frozen-thawed semen (P<0.05); The results revealed that total and progressive motility, plasma membrane integrity and viability were lower in DEX group when compared with other treatments (P<0.05). On the other hand, malondialdehyde concentration was higher in DEX group in comparison with Con, Sel-Plex and Sel-Plex+DEX groups (P<0.05). Moreover, total antioxidant capacity, level of glutathione peroxidase and superoxide dismutase were lower in DEX group as compared with other treatments (P<0.05). Our findings indicated that administration of selenium in dexamethasone-receiving roosters (Sel-Plex+DEX) improved the parameters of fresh and frozen-thawed sperm; but the best results were observed in Sel-Plex treatment. Therefore, selenium supplementation in the diet of roosters without dexamethasone injection improved total motility, progressive motility, membrane integrity, viability, malondialdehyde, total antioxidant capacity, glutathione peroxidase and superoxide dismutase pre- and post-freezing. It can be concluded, selenium in organic forms in stressed and non-stressed rooster's diet might improve all motility and antioxidant parameters in fresh and frozen-thawed sperm.

The genetic purity of sheep breeds is declining due to uncontrolled crossbreeding, so it is essential to preserve biodiversity in native breeds as a national asset. Therefore, the purpose of this study was to investigate the genetic and phylogenetic diversity of the mitochondrial HVR I region between the three Taleshi, Makui and Shal breeds. For this purpose, HVR I sequences of these three breeds were downloaded from NCBI database. Nucleotide diversity for Taleshi, Shawl and Makui breeds calculated 0.0416, 0.04552 and 0.04422, respectively, and haplotype diversity in all three breeds was estimated to be 1.00. In addition, the results of molecular analysis of variance (AMOVA) showed that the diversity within populations was about %100 and in fact the total diversity was included and the diversity between populations was %0. These results indicated high genetic variation in three sheep breeds. Negative Tajima''s D for Taleshi breed indicated that the this population is expanding after going through a recent bottleneck and selection sweep is in progress, while positive Tajima''s D for shawl and Makui breeds demonstrated that these two populations are balancing selection. The NJ phylogenetic test results indicated that all three breeds of sheep were classified into haplotype D. From the classification of these breeds with the Caucasian and Turkish breeds in one branch, it can be concluded that these three breeds are the ancient breeds of sheep and more efforts should be made to preserve these national assets.

The spliceosome is a large ribonucleoprotein complex that guides pre-mRNA splicing in eukaryotic cells. In this research, pituitary transcriptome profile of commercial breeder turkey of BUT breed was studied during the laying and broodiness phases. A total of 334 differentially expressed genes during egg-laying phases and brooding phases were identified. There were 229 upregulated and 104 downregulated at egg-laying phases compared with brooding phases. In the present study results of both GO and KEGG analysis suggested that the genes in the spliceosome complex are critical in the transition from the egg-laying to brooding phase turkeys. In addition, in the calcium ion transport in the biological process, splicing activates and creates various isoforms of the calcium/calmodulin alpha, which plays an important role in the neurotransmitter and hormonal systems of turkeys. In this study it was revealed that SNRPD1, SNRPF and SNRPA1/U2A in spliceosome complex were essential for folliculogenesis and fertility. HSPA8 wassignificantly down-regulated at laying turkeys compared with broodiness turkeys was involved in autophagy and follicular regression in broody turkey.

The Diacylglycerol O-Acyltransferase 1 (DGAT1) gene plays a key role in the production of triglycerides and milk fat by encoding the enzyme DGAT1. Recent research has shown that polymorphisms in the DGAT1 gene affect milk production. Therefore, the aim of this study was to investigate polymorphism in exon 14 region of DGAT1 gene in Khuzestan dromedary camels (Camelus dromedarius) using PCR-SSCP method. To perform this experiment, blood samples were collected from 80 dromedary camels in Khuzestan province. After DNA extraction, a 310-bp fragment of exon 14 region of DGAT1 gene was amplified using polymerase chain reaction (PCR). Six different SSCP patterns, including six different genotypes of AA (45%), AB (33.75%), BB (5%), CC (3.75%) , DD (2.5%) and EE (10%) and five alleles including A (0.619), B (0.219), C (0.038), D (0.025) and E (0.1) were identified. Moreover, the chi-square (χ2) test showed that the population was not in Hardy-Weinberg equilibrium. The number of effective alleles, Shannon index, expected and observed heterozygosity for this site was calculated 2.259, 1.07, 0.557 and 0.338, respectively. The results indicated polymorphism and low heterozygosity in the population under study. It is suggested to increase the diversity in the dromedary camel population of Khuzestan by developing appropriate breeding programs.

The DMB2 gene is one of the MHC cluster genes that plays a role in the humoral immune response. This study was performed to identify the polymorphism of exon 2 of the MHC-DMB2 gene and its association with the humoral immune response in Japanese quail. For this purpose, on day 28, 0.2 mL of 5% saline suspension of sheep red blood cell (SRBC) was injected into 130 quail's breast muscle (65 males and 65 females). Seven days later, cervical vein blood sampling was performed on the 35th day. Afterward, the anti-SRBC titer antibody was determined using a micro hemagglutination technique. Also, genomic DNA was extracted from blood samples and a 333bp fragment of exon 2 was amplified using polymerase chain reaction and PCR products were digested by Hinf 1 restriction enzyme. The results showed that there were two types of C (333bp) and G (226, 107bp) alleles in this region with a frequency of 74.6% and 26.4% in the whole population, respectively. The results indicate high polymorphism and high homozygosity in the studied population. In addition, the results showed that genotype had a significant effect on antibody titers (P<0.01). The CC genotype showed the highest total antibody titer (2.13 mg/dL) and the GG genotype showed the lowest total antibody titer (0.33 mg/dL). It is suggested that the negative effects of this single nucleotide polymorphism be considered in breeding programs.

This study aimed to investigate the protective effects of different levels of vitamin A on ram sperm diluent during storage until equilibrium and before cryopreservation at 4 °C and freeze-thawing.

In this study, 4 Ghezel rams were used for semen collection by the artificial vagina. After the initial evaluation, the samples with normal properties were pooled and after the dilution process, 0, 5, 15, and 20 µmol vitamin A were added to the samples and frozen after 2 hours of cooling. Parameters of motility, viability, plasma membrane integrity, and sperm morphology were evaluated in two steps (before and after cryopreservation) as well as malondialdehyde levels after freeze-thawing.

The results showed that the addition of different levels of vitamin A to the extender during cooling at 4 °C had no significant effect on the evaluated parameters (P <0.05). The results after freezing showed that a level of 15 µmol of vitamin A increased the total motility, progressive motility (PM), VAP, and VSL (P <0.05). Plasma membrane integrity and viability increased significantly at the level of 15 µmol and also adding 15 µmol levels to the freezing medium decreased the amount of sperm with abnormal morphology and the amount of malondialdehyde compared to the control group (P <0.05).

According to the results of adding different levels of vitamin A, the level of 15 µmol has the best performance in improving the evaluated parameters and reduces oxidative stress during cryopreservation and thawing.

The hospital is the first center to fight the Covid-19. This study aimed to investigate the preparedness and resilience of hospitals in the South of Kerman province, Iran.

This descriptive study was conducted on 77 members of the Crisis Committee in 7 hospitals in the south of Kerman province that was covered by Jiroft University of Medical Sciences from April 2020 to Mar 2021. The data collection tool was standard preparedness and resilience questionnaires. Data were analyzed by Pearson correlation coefficient and Chi-square using SPSS 25 software.

The most and lowest frequency of preparedness related to identifying and managing patients and facility communications by 54.9% and 1.2%. Overall, 43% of the preparedness was complete, 52% progressed, and 3% were not yet started. Also, the mean scores of resilience were 194.37±41.40, which was higher than average. The rate of the "Key vulnerabilities" component (70.47±16.68) in the resilience was higher than the other components. Finally, the Pearson correlation coefficient indicated no relation between preparedness and resilience (p>0.05).

Although hospital resilience was moderate, the hospital readiness was at a low level; thus, we should improve the health system to help to improve the continuing education program, psychological support, and planning and decision making to control the crisis of the covid-19 epidemic.

Due to their high efficiency and low ‎cost, electrostatic electron accelerators with a moderate energy,  are used in the industry. In an electrostatic accelerator, the acceleration tube plays the role of dividing ‎the potential of the high-voltage terminal so that it accelerates the beam incrementally in a straight line. In this ‎paper, an acceleration tube for a Dynamitron accelerator with a voltage of 500 kV is designed by CST Studio ‎Suite software. In this design, an electron gun with flat cathode, and a current of 50 mA was used.  In order to ‎extract the beam from the electron gun, two filters are used: electrodes and the lens electrode, with voltages of 495 and ‎‎481 kV, respectively; besides for electron acceleration, 13 electrodes with a potential step of 37 kV have been ‎designed. To hold the electrodes and prevent electrical discharges between the electrodes, insulating ‎sheets made of Pyrex are used. At the end of the acceleration tube, a 50mA beam current, a waist radius of less than 0.5 ‎mm, a 73nm radian emittance, and a 0.15μperv beam were obtained. The dimensions of the acceleration tube ‎and the results of investigating the change in the radius of the electrodes, the displacement and deviation of ‎the angles of the first electrode relative to the axis of the acceleration tube are presented in this paper‎.‎

Application of self-centering rocking walls is now widely accepted as a viable alternative to removal of some of the common seismic defects of conventional shear walls including residual drift and significant damage to the base of walls. Despite the different experimental studies on the seismic performance of rocking walls, few numerical models have been developed to predict the seismic response and damage extent of these walls under seismic loading. The main objective of this study was to present a practical method for numerical modeling and damage estimation for nonlinear behavior of post-tensioned (PT) concrete rocking walls when exposed to earthquake excitations. To this end, PERFORM 3D software was utilized to model self-centering rocking walls. The walls were subjected to a set of seven spectrum compatible ground motions at different intensity levels. To ensure the accuracy of the modeling, the numerical results of the nonlinear analysis were compared with the experimental results, and the results showed that the developed model could predict the behavior of the wall during all ground motions with acceptable accuracy. Moreover, in this study, a damage index was employed to estimate the extent of damage in the developed numerical model. Good agreement between the observed damage in the shake table tests and estimated damage in the developed model was observed. The results of this study indicated that the method for modeling the seismic behavior of the rocking wall could appropriately predict the response and damage extent of these walls under earthquake loading.

Mahyaveh is an Iranian fermented fish sauce produced from fish, salt, spices and water during fermentation period. The main problem related to this product is very high histamine content of it. Effects of starter cultures (Lactobacillus plantarum and Paenibacillus polymyxa) on reduction of histamine in mahyaveh, as “Southern Iran Fermented Fish Sauce” were investigated. This study was performed in 4 experimental groups, including control and treatments on 30th and 45th days of the product. Chemical analysis of treated and control samples revealed that pH, salt percentage, TVB-N content decreased significantly (p<0.05), and acidity increased significantly (p<0.05) in treated samples compared to control samples. Also inoculate starter culture (Lactobacillus plantarum and Paenibacillus polymyxa) reduced the amount of histamine content to about 0.347 and 0.326 mg mL-1 from 0.473 and 0.368 mg mL-1 in control and treated samples, respectively. Results of microbial evaluation revealed that populations of Halophiles, Enterobacteriaceae and fungi decreased significantly in treated samples compared to those of control samples (p<0.05), but colony populations of Bacillus and LAB increased significantly in treated samples compared to those of control samples (p<0.05). In general, addition of starter culture had a positive effect in reducing the amount of histamine and improving other chemical properties and microbial quality of the fermented fish sauce.